Transcript Name :
Phyra_g7128
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_470319
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA recognition motif domain18.069PS50102
HmmSmart predictionP-Valprediction_id
RNA recognition motif domain9.3e-22SM00360
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-118
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
*** None ***
*** None ***
Sequence
        579 bases(100 bases per row)
TGGCGGGCAAGGCGGACAAGCGGGCGCTGTACGTGGGCGGCCTGGACAAGCAAGTGACGGAGCAGGGGCTGTACACGGCCTTCGTGCCCTTCGGCCCCGT
CAAGTCTGTGCAGATCCCCACGGAATACTCCACGCGTACGTCGATTGGGTTGGGTTGGTGTAATACTGGCATGTGCACGACTAACTGGCTGATGGAGCAG
AGAGGAGTAAAGGCTTCGGTTTCGTGGAGTTCGAGGACGAGGCGGATGCGAGAGCTGCTATTGACAATATGGACGGTGGGTGGATGCTTAATGGTGGTCT
GTGGATGGTGGTGTGGCAGTGTCTAAAGGGCTGTGATCATTAGATTCGGAGCTGTTTGGGCGGACGCTGCGTGTCTCCATCGCCAAGCCTGACAAGCCGA
AGCTAGGATCCAACAAACCAGGTGCGTATTGCTGTAGTGACGATGAATGCAGCGACGGAAGTTTGACATGTTACCGGTATCGTTTGTTTTGCGTTGCAGT
GTGGGCGGAGGCAGATGAAGTGATGGACGATGCAGAGGAGCCGAGTCAGGACACGCATGGCAGCAGACCGCAAGCATAG