Transcript Name :
Phyra_g10421
Orientation:
(-)
Number of Exons:
4
Description :
pol protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase9.634PS50878
Integrase, catalytic core16.705PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1209
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        11207 bases(100 bases per row)
TGTGGTTTGCTTCGGAGGTTGCACACTCCACGTTCACAACCTCCACCCGTGCTTGTACGGACATTACTCACCAGAACAACGAACCCGCGAAGAGGTTCTT
AAGAACTGACCAGACGGTGGAGAAGGGTGAAGACTCGGACGAAGCGGAGAGACTGTACATACCTGGGCTCGAGACGGCCACGAACTATCTCAAGTCGATG
ATCGGGCCGACCGTTGCCAGCCCAAAACAACTCAAGGCCTGGCTCGTGGGTGGAGAATCTTCGGACGACGTCTTCGAGTTTCTCAAGCTGGATCAGGCCG
GAGACAACCTCCTTACGAACCCCAACTTGGACGGTTGGGTCACATCTTGTAATCGTACAGTTTTTTCGTTCCGGTACTTGACCAAGCGGTGGACTTTGGG
TTAACAAGCAGATTATTATCCTTCTGTGAGCTTCTTCAGACTTATATATATGTATGTAAATGTTGTCAACAGCGATGAAGCTGTGATACAATCCAGGAAA
GAGCGACCCAAACTCATGCACGAAGAATGTGGCCACAAAGTCTGATTTCGGAGCACTTGAAATGGCAGAAGTCCGAATTTGTATGAGACTGATTAATTAC
TGAATCCTCTTCTCAAAATTTATGTCCAATTGCTCATTTTGAGCGAAGCAAGACCATCAAAAGCAACGCTTTTGAACGACACAGAAACGAATTTCTGACA
GGTTTAACTGCCGTCGGTCTCCAGCCGCCGGTCATCCGAATTTAATTTTGATCATTCAAAACTCACGAGCGATATGAAGATGGTCGCTATTATACTCAGT
GTACCTCAGCAAGCAGATATTTCAGTGTTGGTATTTCGTGCATTTAGCAGAGAACATATAACACGATCCTGAAAGCAAGCATTAGAAAACTGTTATCGAG
AAGTGCTACCAAATCGTCAGCGTCCCCAAACTTTGAACTCTGTCAACATTTCAGTATTTGACGATGCCATTACTGGTGCAATTTGAAGAACTCGTTGTAT
CCGCGCCAAATCTGCGCATCGGGGTTGGTCATCCAAGTCGCTTTGTTCATCTTCAGTATTTTCCAGATCTGCGACGGTTTTGCGCCTTCACTTAGCCACA
TGGCGAACTGCGCCATCTGCAAGTCGGTAGCCATTTTACGCGTGCTGGGTACGTGTTTCGCAGCTTCAAGCGCTTTCGCGAGCAGCTCGTCCCCGTAAGA
TATCGTCATAGTCTTGACCAGAGTTGTTTCCTTCGCAGGATTTCCCCGGTTAAACACGTTCATGTAGGTCACGAAGGCGTTCAAATTCGGACTGGTTAGC
AGCTTACTCACTCCTTCGTCGAGCTTGAGCAGCTCGAACATGTTGTCGACAGATCTCTGATTCCTCGGTCTCACCTGCAATTTCTTGAGGATATCATTTG
CACTGGAGGTCTTCTTCACCGCTTCGAGAACTTTTTGAAGAGCTTCATCGCCATAGTGAAACGTCCATGTCGTGGCCTTCCCTGAGACCGTCGAGACGCT
TGAGATGCTTATCGTCCGTTCTCCGTCGTCGTTTTCACGCGCTTTCGTAGTCTTTTGACGTCAAGATCGTACTGGTCGGCAGAGACTAAGTCACCCAAAC
CCACCGTCGAATCCGTAGTCGCCGAGGTAGCTTCGCTGGCTACGAGTAGAACGGCATTAAGCAGCACGCAATGAAAGAAGCGCATGGCAGTGAAGTCGTA
GTCGCTCCCGGAAATTGGCAATTGAGAAGTGAGGGAAGTGCCGTAAGCATAGCTGCTCTTTTATAATACATGGACCTTATTAATGTACGGAATTCATGCA
ATCATATGACACATTGTGCCCGATTGGAGCACCTCCTACATGTATGCATTAACATATTCGCTGGGGATTGGGACTCCCTCACCTTCTAGTGATACTACAT
ATGGTGCGTCGTCCCGTGGTGATGCTGTTTGTGGTGGTCATTCCTCCCGCAAAAGCTTTACAGTATAATTTCAGTGTTTCATTCCTTCAATTCGCCTCGC
AACGCTCAGTTCACACCCAAATCCAAACCACCATGCGTCTGCACTGGATCGTGGCTTTGGCCCTCGTCGCGTGCGTCAATTTCGCCTCCGCGTCAACAAT
CTCGAAGACGACCGCACAAAATCCAGACGGTGGCTCGTGTTCTCAAGGCTAACCGAAACGAATTTCCCCTCAAGACGTTACTGAGGGCTACAGCGCACAC
GATGAAAATGGCGAAGAACGAGCAGTCAGCGTCTCCGGTCTGGCCGGCGCGATTAAGTCGAAGACGTCAGCGATCAAGGAGAGCGCCAAACTCAATTTGT
GGCTAACTACGAGAAAGTCTGCGCCTCAGGTTTTCAAACTCCTGAAGATCGACGACACGATAAATGACGTGCTGGCGAACCCGAAGATGAACGTTTTGGC
CAAGTATATCTCGATGTACAACAAGAAGAACCCCAACAACCAAGTGTCGATGGTTGACTTGCTCTCGGCTCGTTATGGGGGAGAGGCAGCTGTGGCTAGG
ATGTTCGTCAAGGCGAAACAATCTGAAGCTACGACGAGCCTGGCCACGAAGTTGCAGGCTGAACAGGTCGCGGGCTGGCTGAAAAATGACAAGTCTACAG
ACGACGTTTTCAAAATCCTGCTGCTTGACGACGCAAATGCCAACCCTCTTGGGACCCGGCGCTTGACAGCATGGCTGAACTACATGTCCGAGTTCAATCG
ACTGAACCCTGAAAAGAAAACCACTATGCTGCAGACATTTTCGACGGCCTACGGTGGAGATAAAGGTGTAGCAAAGTTTCTTTATGCTTCCCAGTATATG
TATGGTTCCGAGACCATGGCGAAGAAGTTGGAGACGGCACTCTTCATGAAATGGGCTAAGGAAAGACTGAAGCCAGGTCAAGTCACGAAGAATGTGCTCA
ATCTGAAGACAACAATCGGCCTTACGCGCCAATGCTAAAGCGCTACCCAGGCCTTCTTCAAGAAGAAGTAGATTAGATCCCCATTCAGCGTGGTTGAGCG
ACGTCTTACTTTCGTAATGTTCGGAGACTGGTAAAGCAGGCTCCTTAAAAAATCGCACTCTTATACTCAAGTAGGACGTCTGGTCTGCAAAGAGAAAAAC
GATGTGGGCTACTTAAATGAGTAAACTCGAGCGATGGAAACGTGGTACTTGCTTGTTGTTTATTTCCTTACGAGCTACGCACGAGCGCGCATTGGGGAAG
GAGAGTGTACAAGCCAACTGTAGTGGATGCCAGATATTTCATCTTGGTGTCACCACGCCTGCGGACAAGCTACCCTAGCATGTGATCACAGATGACCCAG
ATGTGTCTGACGGTCGCCAGCCTCAGGCAATGTGTCGCCATATTCTAACCGGTCTGGCTGTCAGTGCCAGATCCGGCCTACATGAGGAACTTAGTATATC
AAGTGCATGTTGCATCCAGGACTCTGTCCACTACATTCCGGCTCTTACGTCTCAGCTCCATGGGGACGCCCTTAAATCAAGCCGACCGAAGTAGATCAGA
GCGAAGGGCTGGTTAGCATCGGACCCGGACCTCACTTCTCAACTTTCCATCTAGCTACCAATCCATCAATACACTCGGCTTAGTTCCGTGCGGGGTGGCT
CCGCATCGTCGTGTGTTTACAGATCGGTACTTCTACCCGGAAACACGACAAAGAATTCTTTAGTAGAAGAATTGCATGTTTCCATCACGCAAGTCACTTG
GGGCAAAAAAGATGTATTGTTTGCTGCGGTCGAGTCGGAGGACGTGGTGAGGCGGGTTCGAGTGCTGCGAACGATGTGCGAACGGAAGTGAGCTACGATA
ACTACACGCTTACTCTAAACTTGACCTGGCGACCTTGTCGCAGTCTGCGATGAAGCAGCACGTCGTCCGCTTCTTATGCTTCCGGAAATAGGAGTATCCT
TCTGGATACTTCCACTACATGTATTATAATCAAATGGTCAGTGTATAACCATTATCCGGATACGATGAACGGAAGCTGGAGATTCTTGCAGCAGTATGGG
TTGTAGGAACAAGCAAAAGTATCCTGTATTCGCCGATAATATCACGCCATAACGATTTCTACGAGCTGGAATGCCCTCCCAAGAACAAACGTGATGATCC
GACGTTGGTGAGCGAGAACGACTGTTAGATTTCGGTCAGATCCACATGACGACTGAAAACGGCTAGATTTGAGAAGCATGCGCAGTTCGCAATTAGCGCC
AAAGTGCACAAGTGGTTCAGGGTTCAGCTTCGGCGCCTTCGGATCCGGATCTTTCTTCTCGGCGCGAACTCCCCCGCGTGGTGCCGAGATGGAGAGAGGA
GGTGATCTCTGTGCGACGGGCACGATGTCGGCTATCTGCCTGGCGTTTGCCACACAAGAATCAGCCTGGGCGTGTGGAGTGGTGACCCCTACGCGTTTTC
AAGATCATCACCAAGGCGCGGCGGACCTGGCGAACCCTTCGCGTTCAAGATATAGCAGTCAAGGCACAGAGGCCGGTAAACCCTCTAGTGCTCAAGACTC
ACTACCAAGTCGCAAGGACAAGGTGACCCCTCGCGCTCAGCTCAACGCCAACGTACGAGGGCCTGATGTCTCTTCGTGTCCAGATCTCACACCGACAGCG
CTTGGGGCCTGGTGTCGAGTTTTAGCTGGAGAAGAGTGTGTTGGTTTGGAGAGGGCAAATGCCGAAGTGAGATTGATTGCTAGCTCTACAATCTACACGC
TGTCCTCCTTTTCTACTGCTCTCCCTGGGCTTCCTTGCTGCATCTCATCGTCCTGATTACCTCCTAGCCATCTTGACTGGATTCCAGTATGCTGTATCTT
GTCGGGATCTTATGCGTATAAGATCTCGACAAGTTCCTCATACTTAACCCAAGTCAGGATATATCAGCCAAACACACCATGCCAGGAACGTGCCGCTCGT
GCCTTGGTCGTCCTATCCGACGCAGGTCATCACTGCATGAGTCCTGTCGTCGTCCTTCGCGCATCCTAACGGCGCTCCACGTCAACAGAGTGTTTGTCGT
TGAAGTTGCTATTGCTTAGAGCCATGGTCGTTTAGTCGAAATGCGGGTTGGTGTGTGTATTTGATAATGAATTGCGTTGGTCCTCCTAAACATGCAAGCC
CTCCTGTGCTACAGGGGCGTCCTAGCTTCTTTTTGCTTGATTCTTTCGTGCCTTTGCTGCTACCCTGCATGTGTTTCTCTTTTTCTGTGGCACTTCTTGT
TCATCTACCTAAATGCATGTTCGCTGTTACTATAGCATGGTCACTGTTACTATATGCATGGTCACTGTTACTATATGCATGGTCACTGTGACTGCTGGCC
CGTCAAGACAGCCGTCACACAAGTGCTTCTGGCTGCTTAGCAAGCATGGCAGAGCCTTCGCGCCATGCGCTCTGGCCTGGTTTCTAAGCAGCCAGACGCG
GGCATGACACCTGGTGAACCCGTCGCGTTTCCGTTCAAGCACCAAAGCACAGAGGACTTGGTGGCCCTCCTGTGCACCTGTTCTCCACCGCTGCGAGAGG
ACTTGGTGGCCCTCTTGCTTCCATAACTCCGACGAATACTGAGCCAAGGAGGCGTCACTCGCATCTTCCTCACCGCCTAGATTTCCAATGGAGGTCTCAA
GACGACGTGTAACACGGTGTCTCGTCGGGGCCGATGGTTCAGGGTACATGTGCCGAGTTAAGTGGCCTTCTATTTGATATTTATGTTATTCCTATAGAAG
GTATTCCAGCATTGTATCTGGGGTTTTGAAAGTTGAATTGTCGAGTCGGGTGTGTTTTCGTCAGTGTCCGAACTGCTTTTGCTGGTGTGCTCCATTGCAC
ACCAAAGAAACGCCGTAGCTTGTGGCCCAGTTCCTGGATGGGACTGTCGCTCTTTGTTGTCTCTGGTTTTGCACTGAGGGCCTTCTGGATTGTTTTATCC
ACACTGTCAATGTGGAGGTACGTCTCTGCTGCGCCTCCGAGATTCTTGAGTTCTTGGAGCGCTTTGCCCAGGATTTTCACCGTTGGTGTAACGGGGTTAC
CTGAAGAGTGCCCGTCACTCTTCCGGGTTGGGTACATGGTGTACCCAACACCACTGACACGTGGTGGTGGCTCACAGCCACCCATACAAAACATATAGGA
TAAACTATAGTTGACTTAGGAATTGTATTGCAAGACGATCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGTCTAAGTCAACCGTTC
CCCAAGACCGGGAACTAGTGAACCGTCGTTCACTTGGAGTTTGTATACTCCTAGCACTTCCTCGAGCGCAAGGTGCTGTGTGACTCCCGTCACACTTGGT
AGCACTTGTAGTCAATCCTCGCCTACGCGGGTAAGATTGGACTACCTGAATCCTCTGTGGTCTCAAACATTGAGCCACCATGGATCGCAGTGAGTTTCCT
CACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGGATGGATGCCCTCCAGAGCTTGGCGGCAGCAACACCTGCCGAGCAGC
TCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCTAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGCTGAACAAAAACCAGTTCAGCC
CAAGCCTTTGAGGCTGAAGGTTAACCCTACGAAGGGAAGGAAGGGGAAAACCTTCACTTCTGGGTCCGAGAGGTCGAGCTCGCTATGGACGCGGCTCTCG
TCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCCACCTTAGTGGTCGAGCAAAGAGCTGGGCGTATACGCGTGAAGCGACAACGCCTGGATGCTT
TGCATCCTGGGCTCAGCTGTGTGAACAGCTTCGAGCCGCCTTCCTCCCGGCGAACTACGAGTATCGCCAGCGCTCACGCTTCCTTGCGTGCAAGCAAGGG
AGACGTGAGCTGCACGAGTACATCCAGGAGATGAGGGAGCTCACCGCATCTCTGGTGGGAAACCCACTCCATGAACACATCAAGGTGACGGTGTTCATGG
ACGGCCTGCGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAGAAGCGATTCAAATCGCTCTTCAGGAGGAGTACAGCCA
TCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGAGGCCCCTTCAACGGTCCTGTGCCGATGGACCTG
AGCCTTGCCGAACAGCACGACATTCGCTGTTTCGGCTGTGGCAAACTGGGGCACATGAAACGTGCGTGCCCCGCGGGAGGAACAACACGGCGGTTTCCTC
CCAAGCCCTTTGGTCCTAGGGGTCGCTGGCAAAAGCCGCGACCCGTGGCCAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGATC
TAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAAGGCTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGAGGGCTGCT
TGTAGTACATGCAAGTGTACGGGGATACGATCATCCCATGAGAATCTTGATCGATTCTGGGGCGTCAAAGAACTTTGCACGCCGCCGGACGGTCGCTCGC
AAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGCAAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACTGTAGTGGAGGTGCCCAAGGTCT
TTATGGACCTGTCCGTCAAGTTTGAGGACTTTAATTCCACTGAACGATTCCTCGTTCTTGATATGGACAAGTACGACTTGATCCTGGGCATGCCATGGCT
TGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGCCTGCTGCTACTGACAGAGCATTGGTGAGTCATGTTCCCACCTCT
GTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCGGAAATGACTCCGAAGAAATAGTTACGGCAGGAGCCGCAACAGGTGTCATGACACCGTCCACCGCGG
GCAACGGACCGCCACAGGCAATGCCGGTGGACAGGACGTCGAGTCCAGCGAGGGGAACTGCAATGCCAGCAGTACCCACCGCTCCTGACTATGGCACCGT
ACGGCCTTCGGCCTTATTGACGCCGGGGAAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGAGACCAAGGAGGTCGAGACCGTGGCCAGGGTCGAGGTT
GCTGGGAGCACCTCTGGTGTGGGTAACAATGTGCCACACGGAGTCGATGGAACTCCCGACTCCACCCTTGAGTCACCACCGGCTGTGGGTAACAAAGGAT
CATGCCGTGGTGGGCATCGACGACGTCGCCGCCGCCGTAAGCCGAGTCTGGTGAGATAGACTGGAGTCGCTACAAGCGACTCGGAGAGAGAGAACTCTCC
TCAGGCACGGCCGGCCGAAGAATGCTATCACTTCTTCGACGGCGAGACCGGGTGTACGGTCAAGGCGGGCTCCACAACGTTGGCAGCCCTGCCTGAGGTG
TCAGAGCTACTGAACCTCGAGGAAATGTCGATGGACGATTTCCTGGCACAACTGAAAGCCGAGGCAATCGCGGAGATGGTGCTCCTGAAGCCGGAGGCCT
CTCCAGAAGAGCTGAGCTCCTCTTCCGTTATGGACAAGGATGTCCTGGACGAGCTTGGCAAGAAGCGCGCAACGCGCACGGGCTCTGCGATCCTCGAGAA
CCCCAAGGATCCAGTGTATCCTTTGGTGAAGGAGTTCTCGGACGTGGTGTCCAAGGACCCGCCGTCCCAACTCCCACCTGACCGAGGAGTTAGGCACGAG
ATTGATCTCGTGCCAGGCACAAAGTACTGTGTGACCAGGCAATGGCCACTGCCTCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAGGCAA
AGGCAGGCATGGTGCGTGAGTCGAAGTCTCCGCACTCGACGCCCACCTTCTGCGTTCGCAAGCCGAACGGGAAGTGGCGTCTGGTTCATGCTTATAACAA
GCTGAACAGCGCAACGGTGCCCGCCCAGACACCCATTCCCCGCAAGGATGTGTTGTTGAACAACATGGCGGGCTGCGAGCTTTATAGCGCGCTGGATCTG
GTGGATGGATACTACCAGATCCTGATGCTCGAGCGCGACATCCCGCTCACGGCGGTGAGCACCCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCAC
AGGGCCTATCAAATGCCCCAGCGACTTTCAATCGCTTGGTCACACAGTTGTTTAGACCCTTGCGTGCGTTCACGCAGACGTACTTTGACGATATCTTCGT
CCATAGCCGTGCCGGGGAAGGCAAGACGGCTATCGAGGTGCATCTCGAGCACCTCCGTCGAGTGTTTATGGTCATGAGAGCAAACAAGCTCTATGCCAAC
ATCGACAAGTGCGTCTTTGCGGCACAAGAGATCAAAGTTCTCGGCTGCTTCGTCAGCAGCGTCGGCGTTCGAGCCGACCCTGAGAAGGTCAAGGCCATTG
CGGCCTGGCCCACACCACGATCCCAAAAGGATCTTCGCAAGTGGTTGGGTCTCGCCAACTACTTGCACAAGTATAGTGCGGGGTATGCCGGGCTGGCACG
ACCCCTGTCGGATCTCCTTAAGAAGGATGCCGACTGGCGCTGGGAGAGCCGTCATCAGGATGCATTCAACAGCATCAAGGCGAGCTTGCAGCGCGCGCCG
GTCCTGGCTTTGCCGGACGAGACAAAACCGTTCAGCGTTGTCTGCGACGCCTCCGACTATGCCATCGGTTGCGCGCTGCTGCAACACGACGCGGACGGGC
ACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTTAAAGCCGCCGAGAGGAACTACCCTGTCCATGACAAGGAGCTCCTCGCAATGAAGTATGCCCTTGT
CAAGTTCCGGGTACACCTCCTGGGCTCTGAGCCCTTTGTGATCTATACAGACCACGCGTCCTTGCGGACGGCCACCAACTCTCCGCATCTGTCTCAGAGG
ATGGCCCGCTGGCTGTCATTCTTCGCGGAATATAACTTCCGCGTCGAATACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGCGTTATCCCGTCGACCCG
ACTATGAGCTCGCGCACATTAGTCGGGTTACGACAGATCTGTACGATCGGATACGCCTGGCGTATCGAGATGATGAGAATCTCTTCCCCATCGTGCGGTT
CCTCACCGCTGGCAAGGAGGCCAAGCATGCATGGCTAACGCCCCGCCATCGTGCCCGCCTCCATCGCTATGCGTGGGTCGATGGCCTCCTCCACTACCGC
GTGGATCCGGCCGATCCTCCGCGGATAGTCGTCCCCAACGACGAGGATCTGAAGTATGACATACTTCAGGAGGCGCATGATGTGCCTTCCAGCGGCCACC
TTGGCCGCGAAAAGACCTTCTTGTCAGTCTCCCAGGTCTTCTGGTGGGCCCACATGTACAAGTGGGTCGCCACGTATGTAAGGACCTGCGAGACATGCCA
GCGAGTGAAACCTGCTGGTCATGCCTCGGCTCCTTTGCAGAGCCTGCCAGTCCCGGAAGACTGCTGGAAGTCGATGAGTCTTGACTTCGTCTTCGGACTG
CCGGCTGATGCCCAGGGCAACACCGGCGTCCTGGTGTTTGTCTGCCGCTTGAGCAAGATGGTACACCTTGCTCCGGTGGCTGACTCAGTCACCGGTGAAC
AGACTGCACGGCTGTTCCTGGATGGCGTCTTCCGCTATCATGGCCTCCCTGAGACTATTGTCTCTGACCGTGACCCACGGTTCACGTCTGCGTTCTGGAA
AACGCTGTTCCAATTGCTTGGAACACGGCTGCTCATGTCCACGGCCGACCACCCACAGACGGACGGCCAGACGGAGCGCGTCAATCGCGTCCTCGAAGAC
ACTCTACGCAGTGTCTGTGCCGAATCTCCCGGCACATGGTCGGCCAGTTTGCCGATGGTTGAGTTTGCACTCAACAACGCGGTACACGCGTCCACGGGGT
TCTCCCCGTTCTACCTCAACGGGCTCCGGAACCCCCTGGTGCCACTCACTCTCCGTGGTGACACCGCGGCTTCGGTCGTAAGTGGGGGAGAGGCTCGGAA
AGCTCTTTCCTCCCAGGTGTCAGACGTGACACCGGCTTCCCTAAAGAAGCAGTTGTCGACTTTTGTCGACAACAGGCTTAATGTGATAAGCCGGGTGCGC
GACACAA