Transcript Name :
Phyra_g12221
Orientation:
(+)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Integrase, catalytic core14.763PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-744
NN-scoreoddsWeighted Score
0.5273.8380.008
PositionContextScore
229TPGRRPR|GA0.576
TypeScore
cytoplasmic47.8
GO
Biological ProcessGO IDPrediction Method
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        8083 bases(100 bases per row)
ATGGACTATTCTGACGCCAAGGAAGATGACGAAGAAGATGACCTGGAAGAGAAGGCAGCTATGCCCGAGCTTTCGGAAGCCGCTGCAGTATCTGCAGGAC
GCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGCTGGTCCCGAACCAGCCAACGGTTACGACGAAGATGAGTCCGA
CGATCACCGATCGTCGGCGATGGCCGAGGATGCGAATTCTCGGCCGAATGGCGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAACCGAGTTCTG
GGTCGATACCTAGAACTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCGGTGGCGAGT
TAACTGTGCCCGTGGAGTCGTGGAATACTCGGCAGGTGGCCGAGGACACGGTGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGTGTTCCCGTCGGA
AGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGTT
AGCCGTCCACCGAACGTCCGCCACGCATCGGATCCGGTCGACCCGTCCATGATTCCGTTGCCAGTGACCCCTGGGAGACGCCCCAGAGGGTCGACCGAGG
CCGGAATATTTTCGGCCCAAGGTGCGACGTCGTATTTCCAAGACTCTCACATGGTGACGCCGAGGTCGGTCAGTCGTACAGAACGACTGGCGAGAGAGGC
CGAGGGATATCGAACCGCTCCGACTGCTGGACGAAGCGCAAGTCGGACGCCCAGCCGACGTTACGACCTCCGCGATGACTCATCTGACGAAGATTCGTTC
GACGTCGGAGACACCGGGGGTGACTTGACGGGAGAATGGGCACGCCAAATTCGTGAGCTGAGCGCTGTGGGAATGACAGTGCGACACCGAGGCTAGAGAT
CGCTACGCATCTCCCACTCGGAAACATCAAGCCGTACTTGGGACTCCGCGATAAGAGCGAGAAGTCCATGCAGTGGCTCCGAGCGTTCATATACGAGATG
AAAGGGACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTGCATTGGTACCGACAGCTGCCCCGCAAAACGA
GACGCACGTGGAAATTGTTGAGCGATGCGTTCATTAAGTACTACTGTTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGGCCAAGCGAGAGGA
GAAGGAGCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGATGCAAAGGACCACGTC
GAGCACTTCTTGGATTCGTGCGAAGACCGAGGTCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAGGATATGATCAATGATA
TCCTTCGTCGCAGAGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGGTAGCACGCCGACGCGATGGTGGACGCTCCGAGGA
TCCGCGGGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACCGAGACGATAACCGTCGCCGGGATGACCCAATA
TCGACCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCTCGGTGGACGCGCGTGGAGGATACCCGGAAGCGTAC
AACGACGGATATGATGACACCGAGGAGTATGGGCCGGAGTCTCACTCTGGCGATGACGACCGATACTCCGAAGGGTACTCGGACGACGGATACGCGTCGA
CCGAGGACCGAGGCCACGTGGCTGCTGCAAACGACTCTGAACGTCGCAATGCGGCTGAAGGAACGTTCGCTCGCGCCGACAACCGTCGGCCGAGGGCAAG
TAACGGCCAACGCCCGTATGACCGAGACGACCAGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGGTCCATGCGCCGCCTGCGGAGGACTC
ACCCATTCGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAAACAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAAGAACTCACGAATCTCCTCC
GAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTC
CCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGCATTCGCAGGTGTGAGCAAACGGCCTGATGACTTGAATATGGAAT
ATGTGAAAACGACGGAAAATGTAAAGGAGAGAGGCGTAAGCCTCGGTGAGAGTGAAGTGAATGGACGACGTGTGGACGGAGACGGAGTGGAGCTAACCGA
TGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGGGGTGGTGGTCATCC
CAGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGACTCGCGAACGAGGATTCTGCTGGACACTGGAGCGAATGTCAGTG
TGATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCGAGGAATTAACCCAGGGGTGATGGAGAC
CCGCAGACGAGCACTCGTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGGTTATGGATCACAGTGCAGGAGTGGACGTGGTCCTG
GGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACTGCGAGACTACCGGACGAGGTAATGGTGCCCCTGGTGAAGTCGCAGA
ACCCAGCAGAGGCCGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTCGGTCCCAGGGCGTGAGTGGCGAGAATTTAGGTTACCACG
ACGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGAGGGCAGCCGACGATGGTG
CGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTACTGCTGTGGGTGAAAAAGGGTGACCTGCCGCAAGGGATGGATACAC
TCGTTTGAACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCAAACTCTACGAACGA
TGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGACGACTTGGAACCTAGACGAGGGC
CAGATAACGTTCGCGAATAGGGCACTGAGGAACCGACAGAACGAGACCGAATGCCGTTGACGACTTCGACCCTCTGACGAACCCGTTGGAGATAGATGGG
TCGACGAAGATGACGACTCGGTGGCGACCGACACCTCTGATGGCGCGGATACCACGTATACGAGTGAAGAGAACTCCATCCCAGTCCTCGGTGATGACCC
GGAGACCCGATTGGACTCTGCCTTCGTAGCAATGATGCATGAGATTACCCGGGGGACGGTTCAGGTAGTGGAACACCGATACCAATACGTCCGAACATTT
AGCGAATGAGATCGAGTTGACGGACTATGCACACGAGTTGGCGTTCTTACCGGACCTGACCGAAGCCTCGGAAACGGTACTGGATTATTCAGGACCGAAT
GTTCTGAACCCGAGCGCGACAGCCCGTCAACAAGAAAGTCTCGTTGCGGTGCTGAAACGACACGAGAAGATCATGATTGCGAGTGGGAATGCTCTGCCAC
CACCGGCCTACGGTGTGGTGTGCGATATTGACGTACAGGGGCATCCACCCATCAAACAGAGAGCTCGGAGAACACCGCTCCGACACCTTCGGAAGCTGTA
CGAGCTTCTGAAAGGCTTGCTGAAAGCTCGTCTAGTGGCGTTTTCGGACAGCCCATGGGCGTCGCCCATCGTGATCGTGCTCAAGAAGAATGGAGTTGAT
ATTCGGTTGTGCATCGACTACAAGCTGGTGAATGCAGTGACGGCGATTATGGAGTACGCCATGCCGTTAGTCGACGACTTGTTGACCGACCTGGAAGCCT
ACCTATGGTTCTGCTCTTGATGCGGCCAGTGGATTCTGGGCTATTATGATGACGATGCGGGCCCGCAAAGTCTCGGCATTCGTCTGTGCACTCGGACATT
TCGAATGGCTTCGTATGCCGTTTGGATTGAAGAATGCACCGATGATTTACCAACGAATGATTGACAATGCTCTGTGGGGTTTCGTCCAACCCAAAGCTGG
CTCCACTTTTCGGAGCTTATGCGAACGGCCGAAGCCCACGCCGAGGTTGCGCGGACAGGGGTGACCGACCCTTCATCGCGACGACTCGAGGAGTCAACAA
CTCGGTGACCAAATTCGAGGCCGACCGCGAATCCTCGGTCACGCTTGACGCAGTGAATGGGTTAGTGAACAGCCCTGTTGCCGACATGTTCTCCACCGGA
GAACCGGATGAATCCTCGTTGGTGCCAGTGTTCGACCGACGGTCGTTTGTCGATGATATCTGTTTTGGGTCCGAGACTTTCGACGCGTGCCTGGAGACGT
TAGACCGTCTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCAAAGGTGGATTTCCTGTCACACGAAGT
CTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGGATGCAGTCTTTCCTCGGTGCG
CTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGTATGGAGCAGCTTTGTACCAGTTGAAGGACGAAGACTTCACGCCTAGTGGCAGCCTCTCGG
CAGCCAAACGAAGCTTCGCGCGCTCCAACAGAAGGTTGCAGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGTGCATGTCACGTTATTCGCG
AATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATGATGACAAGCTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACT
ACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGTGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTC
GACGCTCGAATGGGTGCACAAATCAAGACACTGTTCGGTCGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGG
AACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCAGTTACACCGCCGACGAAAGGGTC
ACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAG
AACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACC
TCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCA
GTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTTCAACTGAATCGTCACCGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCAC
GTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAAGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAAT
TGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGC
CCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAACTGCAACAACCAGACACCAAGCAAAAGCGAGGAAGAAA
CGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGAATGGAGCGGCGAGCGAGACGAAGCGAATGGTGTGACCACCGAAGCTCAGAGTGAGCTGAG
AGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCCAAACGCAGAAGACGTTGACCCTGTGGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCC
GCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAACAGACCTCAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGG
CCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTATTTTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGATGCGTCTAGT
GGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCA
GACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATT
CGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGGCAACTCAGCCCTACTACT
GTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTCAGACACTACCGCTCTGAGGGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGA
TTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGA
CCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGCTGCAGCAAGA
CTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAACAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCA
CAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAACGAGGATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAA
TCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGAAAGCTCGGAGGGCGAGAGAACACAATGAGTCGCTGGAGCGACGTGAGAGAGCTGCAGTACC
GAATGTCGATGAAAACGAGACTTCTGACGAGTCACAGGTGGAGACGGGGGCAACATCTGATCCCACTGTCGAAGGACCGAGGTCTCTGTTCCAACCCGGA
AGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGGGTTGACCAAGAAACTCGCCCACCGATGGCATGGACCATTCAGGATCAAGAAAAAGATCGAAG
AGTTTGCGTACGAGTTGGAATTGCCAGACCGAAGTGGGTATAGGTTCTACCCGGTGGTGCACGTGTCCCGACTCAAGGCCGTCAACGAATTTGGAGACCG
ACCGAAGAGTCGGTTAGCACCTGAAGTGACCGAGGATACGAGACTGGACTTCGACGAGGAGTTGTTGCCTGAAGATAGCTGGGAGCCAGACCAGCTCGCT
GGCGAATATGAGGTAGAAGCCATCCTCGATGACCGATCCCCGCTGTCGACGGGCACTAGCCGCGCTGTCCGAGAGTTCAAGTG