Transcript Name :
Phyra_g1297
Orientation:
(-)
Number of Exons:
11
Description :
cyclic AMP-dependent protein kinase-like protein regulatory subunit
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
cAMP/cGMP-dependent protein kinase2.2e-21PR00103
cAMP/cGMP-dependent protein kinase2.2e-21PR00103
cAMP/cGMP-dependent protein kinase2.2e-21PR00103
cAMP/cGMP-dependent protein kinase2.2e-21PR00103
cAMP/cGMP-dependent protein kinase2.2e-21PR00103
Profile scan predictionP-Valprediction_id
Cyclic nucleotide-binding domain38.248PS50042
Cyclic nucleotide-binding domain37.025PS50042
HmmSmart predictionP-Valprediction_id
Cyclic nucleotide-binding domain1.2e-24SM00100
Cyclic nucleotide-binding domain1.3e-26SM00100
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclic nucleotide-binding domainIPR000595
*** None ***
InsideOutsideTMhelix
1-703
*** None ***
PositionContextScore
13NWKRFAR|DL0.66
*** None ***
GO
Biological ProcessGO IDPrediction Method
cAMP-dependent protein kinase regulator activityGO:0008603IEA
cAMP-dependent protein kinase complexGO:0005952IEA
*** None ***
*** None ***
Sequence
        8290 bases(100 bases per row)
TGTCGCTCCCAGTCACAAACTGGAAGCGTTTCGCTCGCGACCTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTG
TGAAGCAGAAGAGCTGAAGTAGCTCATCTATGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTC
AAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGAT
TGATCTCGTGCCGGGAACGAAGTACTGCATCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGAAATCGACGACTCTTTGAAAGTCGTCGCAAGC
AGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTAGTTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTG
AACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAG
ACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGG
CTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACA
GCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAA
GAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAA
TGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGC
TGCTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCT
TGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGA
TCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAG
TTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGG
CACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTA
TGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGAT
GCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTG
TACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTATGAGTA
CCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAG
TACGTTCGTGCTTGCGAGGTATGCCAGCGTGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCA
TTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGC
AGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGAT
CCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAG
AGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAA
CTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGT
GGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATG
GCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGAACAACGCGCAGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGG
GGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAA
TGCCGATAACACGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCG
GAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCA
CCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCG
AACGCCAGAGAGCCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTCAACAAGCTCAGCTCCTGACGCAGA
GCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCCACCCCCGTT
GCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGAGAGGA
TTTCCTCCCCAACACGATACGTGGGAATCACGGAATGTCCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCC
GAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTG
GCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGGACGTGTACCCGTTGACGTCCCGCTCGGTGATGCGTACTGCTCCGGGTAGCAGTACTCACAAGC
AGTGTCATAAGGCACTGCGCAAGGAAGTCCAATACCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAATTCTCGTAGCGCTCCCGCG
CCTGGCTAATCCGGTCGCGATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAAGGCACTCCAACTTTGACAAAGTGCCTGCCACTCGGGCACTTTGCT
TCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGTACTCGC
TTCGCGACGTCATCGTCAACGATGGCGTTGCACGAATACAGCGCGTACAGATTCGGTGGCGCGGTCGCACCGAATCGGCTGCCGATCTCAGACTGAGACG
GCATCCACGGCTCGCGCACTGGCTCAGTGCGCGAGGCCGCAACAACAGCGGATGGAGCAGAGTCATCTCCATCCCGCGGAGTCGTCAAGGCTCCAGCGGC
AGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCTCGAAGCGTTCGGTCGTCCTCGCGTGGACGACGCAGACCCACATTGGGGTCAGTGTGGC
CCGGAGACAAGGTGTCCTTGTCTCCTTCGAGTTCCCCCTCCTCGACTTCACTTCCGTAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGTAGATACCCAC
TCCGGTTTCGACAGCAATGATCTTGCCTGTCTTGTTTCGGATGGCATGTTTCTCATGCCATCTCGAGTGGTATCCAGCAACAGAGAGGCGACTCTCTGTT
GCCGCGCTTGTCGGCATCGCGTCGAGGCGATGCCAGTAGCGGTCGTGGCTGAGGCAGCGGCCGTCGTCGCCTTGGAGGCGACGACAGCACTTGCTGTTGC
CGAAGCGGCCGGCGTCTTGGACGAAGACGTCGTTGGCGTGCTCATTGGGAATGAGCACGTGTTCTCCCGAAGAAAATACGGATTGACGTGTCGAGACCGG
CACGTCAAATCCTAACGGGGGGATGGTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCA
CCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGC
CATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCGTTTGGTT
CATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTA
AGTAGTGGGTCTAAGCAGACCCATTACAGGGTTGGTACACATCAGTAGGTCGTGTCGGTGAAATGGAGCATCGACGCTGCTTCATCCTTTCCATCAGTTG
TGGACGCGCCCAACCAATCACCTGATGCAAAACTTCATCTTCGTAATATGTGGAGTGGAACCTAAAGATCGTTACCCCTGGTCTATGCTTGACGTCGCAT
AAAGGCTCGCCAGAAAATGTACCGACCGAAATGGTTCTTTCTCGTCTGGTACAGTAACCCATAACCTGTTTTTGGTTGCACCTTGGACGACGACGTTGTC
GGCGCTGTAGAACCGATCCCGGATAATCTACCACACTTCTCTCGGGGTCAGAGTTATGTCGCGGACGCCGATGTCATCCGAAGCCAGCAGCATCTGTTGC
TTCCAAATGACGAAAGTAGGTAGCGATCCACTTGGTCCTTGACGCATTTCTGGAACGCAATCAAATTGATGCGTCCCTTGAACTACGACTCCTAGTCGAG
ACACGCACAGCTTCACCAAGCAGTTGGTGTGTCGATAGATGCTGCAGCGATTGTTCTTGGTGGACCCTCCATGGTAAAATGCGTAGGGATATCCGTCGTA
GACAACCGACTTGGAGCCTGGAACACATCAGGAAGCTTAAAACCGGTGCCAACTTCACGATCTTCAACTTGAAGACCATCACTCTGAAGGGAATCAGAGC
TTGTGGACTGGTTTGGTATGATCTCGGTGTCTGCCGATGATACATCACTCATTTCAGAGCCTTCGTAGAGAGAGACACCGGTATAGACGGAGTCGGAGAG
GATGTCGTTGAGGTCGAACTGCATAGCCAAGGTGCCAGACAGAAACGTTGGAGTGGAGCTTGGTGTCGAGTCGTGATGATTTGAAAAGACTACACTGTGC
TGCGCTATTGTCAAGATTCACTCCAACTTATATATAACGCCAATAATTTGCACGGGAAGCGTCAATAAACAGTTTGATATCATTGGGTAATGATTGGGTA
AAAAAACAATTGCCTGCCTGTCGTGATAATGTTCGATCATCAGTTAACCTTAAAACGAGCTGCGCAAGACTTGGCCACACAAAAAAACGAGTTGCGCACG
ACTTGACCTTCGCAGCGTTTGACCCCCCAAAAAATCACTCCGTAATTAGTCGAGGCTCGACTAATTAGGGTGAGCAGTGAGCCTTTGCGCGGCAGTATAT
GCACTCTTACTACCCGTGCGAGGTAAATTGCTGGTTGTAGCTGCAAATTTGCTGGTATAACAAATTCCAGATATTAGAAAGGGAGGTGCCTTTTTAAAAC
GATCACTATCGCCTTCTGCCGGGTATACGTTGTCTAAATTGACAGGTGATGATACGGCCTTGCCAAAAGTTGCAGCCAACCAAGCGTCGCGAGCAGAAGA
AGCGCGGCTATTTAAATCTCCTTGGGCGTGCCACTACAAATACGTGCACGACAGCCAGAGACCAGCAGAGCAGAAACCAACGCTCTCCGTTCTAATCTGG
GAGCCACTACACAGGCAGAGCAACGACAAGGGGCGATCTTTCGCTTGGGTTCAGCGTCTGTTGCAGGGGTTTCTTCCATTTTGGAGCGAAGGCCCCGTGA
CGCCAGGCTCAGTTTAGTTTTCAGGCCCACGCAGAAGCCCGAGACGGAAGGATCCAGCTAGCCACTCGCAAGACGACACTCGCCGCACAGGAGCATGACG
GACGCAGAGGGCGTCCAACAGGAGCTGCAGGACTACCTGCACAAGAAGGGCATCAACACGCTCTTCATCAACCTCGTCGAGTCGCTGCTGCTGGCCAAGC
CCGAGAACCCCATCCTGCACATCATCCAGTACCTGCAGACCAACTACCCGGAGGAGGCCACACCTCGCCGCAAGCCTGGGGCCAAGGAGGACAACCCAGC
CGCCTCGCCCCACGTGCAGTGTGCGTCGTGGGCAGTTACACTACCTAATGGTAGAGAATGGAGATCTAATGTGCATTTTCTTGGCAGATCATTCGGACGA
GTCCGAGAGCGAGGACGAGGATGAGGGTGGAGACGCCGTGGGCGAGATCGCAGCCAGCGCGCCGCCGCCCAAGATCATGGCCAAGGGACGGCGCACTTCG
GTGTCCGCTGAAACCATTGACCCGCTGAGGTGAGCAGTTTGTTATGAGGTGGCGCTGTCCTGTCTGATGGTAAACTGACTTGGTGTGACGTGGCAGTGCG
CGGCAGTTTGAGCGCGTGGTGCACCCCAAGTCTACAGAGGAGCGGGAGGGCATCAGTCGCATGGTCGTGGAGAACATTTTGTTCAAGTCGCTGGACGAGA
AGCAGCACGAAATTGTGCTCGACGCCATGTTCCCCAAGGAATTCGAGCCTGGTGACACCATCATCAAGCAGGGTGACGACGGAGATAACTTTTACATTCT
GGAGAGCGGCGTATGTGAAGTTTACAAGGACGGCGATCTCGTACAGACGGTGGGTTCACTACTGAAGGGGTTCTTGCTTTTTTTCAGTGGCAGGGTGCTC
ATGTTTTTTGTCTTCTGATGCAGTGCACTGAAGCAATGTCGTTCGGCGAGTTGGCCCTCATGTACAATGCTCCGCGAGCAGCAACCGTTAAAGCAGTGCA
GCACTCGAAGGCGTGGGCATTAGATCGCCAGACTTTCAAGTTTATCATCATGGAAACGACATTGAAGAAACGCGAGGCCCACAAGGGCTTCATTGAGCGT
GTACCACTGCTCGAGTCGCTCAGCGAGTACGAGCGTCTCACAGTCGCAGACGCTCTGAAGACAGAAACGTTTAGTGATGGCGAAGTCATCATCGCACAGG
GTGACGACGGCAACCTGTTTTACATTATTGAGGAAGGCTCGGCAGTGTGCACGAAGCAGCTCTCGCCCGCAGACCCGCCAGTGGAAATGGGCCAGCTCAC
ATCCGGCGCGTACTTTGGTGAAATCGCACTGCTCACAACTCGGCCTCGTCAGGCAACAGTGACCGCCCAGGGCAAGGTTAAGTGTCTCACGTTGGACCGT
AAAACGTTCAAGAGAGTTATGGGCCCGCTAGAAGACATTCTGAAGCGCAACATCGACAAGTACAACTCGGTCATCGCCAACAACATTTAA