/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_a06ebf866afba8b9c2d3f2210adcaf26 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1330343 -w 120 -web -o /tmp/images/bd_log_output_file_a06ebf866afba8b9c2d3f2210adcaf26
Transcript Name :
Phypl_g3
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_552380
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Target SNARE coiled-coil domain11.644PS50192
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-186
205-206
187-204
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        976 bases(100 bases per row)
ATGAGCGCGACGGCGTGGGCCTCGTGGCTGGACCGGCTGgagagcgcgcgcggccAGGAGCAGGTGCTGTCCAGCAAGATCCGCACAGGCAACTCGGGCG
CGATCGgcaccagcgtcttcgcgctgcagcagagcgtcTCGCGGCTCAAGCGCGacttcgaccagctcaagcgATCCTCCAGCTCAGTGTacgctcggct
gctgctgctactatGAGCAAGTGAGAACGACACCTTGGGGACCAACTTACAGTGCTGGACTGCTGCCACACAGGACAAAAGAGGAGATCGAGCGgcgcga
gcggctgctgAGCCAGTTAGCACGGGATCAGGTGCGTCACCCGGAGCTTCCACGGCTCCTCAGGGGCGGATAAAAGCAGAGCAGAGCAGAGCGTGACTGA
CGTATCGTACAATGTGTGTTTTGGCTGCGGCAGCAAGAGGACTTGGATATGCATAACAGTCGGAAGACGTCGAAGGCTGCAGTGAGGTGCGTCTACAGCC
TGAAGCGAAGGATGGCTGCACACACGGATGGATAACTGACACTTGTTGTGCTGGTTGCCGGCACTGGTATCGGATGCAAGCAGTCCTggcgcggcggagg
cgccgGGGCGGCTGCTGAGCATGCAGAACCAGATTATGAAGGACCaggaccagcagctggaTTTGATCGGCCAGGGCGTGTCCAACCTGCGCAACTACAG
CCTCACCGTCAAGgacgagacggagctgcacgtgcggctgctgaacgagatcgacgacgatgtgTCCCGCGTCACGGACGGACTCGAATCCGagggcgcg
cgcgcagcacgggTAACGATGAGCTCTTGGcttttcttttttttttcattcTTTGTCGGTGCTGACGCTCTCTCCTCTCGTGCCAGGTGGCCAAAGcaag
caacaacaccaagcTGTACCTCATCatcctcgtgctcgtggtgaTCCTCATCTTCCTGCTCCTGGCCGGCGGATAG