Transcript Name :
Phypl_g41
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ferredoxin reductase-type FAD-binding domain5PS51257
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
33-228
1-9
10-32
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1134 bases(100 bases per row)
ATGCCGAATATTCGAGGGGCAGCGGGCTCGACGATGAGCATGCCAGGTTTGATCATTGGCTGCGTGCTAGTGGCGTTAGTCGTCCTGggcttcctccagc
agcagatgctcAAGCGCAAACGACGAACTCGTACGCATAGTAAACATTGCTCCTCGTATGCCAGACAGGATACCACGATTCCTGACTTCTGTGCTGCGCT
GTAGAATATCACCCTCCCTTGCAACTTCAACAGTCCAGCAGAGGTGTGTTGGAACAGATTGGGAAGCGCAAAGAAGACCTCCAACGCTATATTGGCAAGC
TCAGAGAGCAACTCGCCGCTCGAGAGGATCAGCTACGGTaccacgacgagctcgaggaaaTCGTGACTTCTCGCGTGGAAACCAGTCGACGCGACGAGGA
GGTATTGCTCCTTTTGATCCATTTGCCTCGGAGCGAACATGCATACTAACTTTTAAGGTGCCTCGTAGGACTGGACAAGACTTATGAAAGCAGGCAAGAA
GATCCACGGTGACAACTGGAATACCTCCACCGAGGACGAGCCTTCACTCAGGTAACAACACGAATCGTCCCAACTTAAGTTTTCACTTATGCTAGTAAAA
GGGCTCACTCACTGATTAATCACGCTCATGTCTAGGGAGCTAATGGAGCTTCACAAGGAGGAGCTACTCGAGTACAAGCGCTCGCTTAAAAGCCGACCAG
AATCGAGTCGCCGGCCGCCAACGTCCCTGGAGCGGAAAGCTGTACGACGTCCGTCAAAGTTTAACCTCCCTCTGTTAAAGCTGCAACCAGTAGCCCCGCT
TCCAAGTGCTTCGCGTACAACGGTGAAACCCAATGAACCAAAGTTCATACCACCTCAGTGGCAATCCACTCGCGCCAAGGCAGGATCACGGCTTTcagct
gctgttcctgccCAGTTTGAAGTCCAGGATGACGAATCTGATGCATTTCCACCACCGACACAGAAGCTGGCAGTCCCGCCACTAGACTTCAGCAGGATCA
CAGGTAAACCCACCATCGGTGTATCTCCTGCTGACAAACCGGACGAGCCCGCACAAAAGCAAAAGAGGAAGAGCTTCGAGGCCACGTTCCAACGGCAGAC
GCGGCTGGCAGCTATGCTCCGAAAGAAAAAGTAG