Transcript Name :
Phypl_g1
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1303
NN-scoreoddsWeighted Score
0.6211.8580.004
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
*** None ***
Sequence
        5886 bases(100 bases per row)
ATGTTCGAGCACCTACCGCCTGATTCAATCGCCGAGTCGCAGCTTCGCGAGGTCATGGATGCCACACTTGCTATTCTCGACCATCCATTTGCTCTTGGAG
ACTTGACCCGAGCGCGTAATGCTGTGGGTTTCGTGTTGCGGTATGGACTCAATGGTTGTTTGAcagagcgccagcaagagGTGTTGCTGAGCGCATATCT
ACAAAAGCTAAAAGATGAAGCACAAGCATCAGAGCCGAACCACCACAAGATATTGTCGGCGTTAGTGGAGGTGAGCCACATGTTCCACTCAATGGGCGAG
GCTTCTGTAACTCATGGGCGTGATGCCAGCGACGTATTCCAAGGCCTTATTTGCCATGAAAAGCAAAGTGTTCGCtttcaagctgctgtcgcgctgGCAT
CTCTTGTCACCGCCATCCCGTACCGGCTTAAAAGTGTGCTGATGGATTGTCTACAGGGTCTTCGAGATACTGCTGAATATCTGATGCGCGGAGGCTCTGA
TGTCGAAGAAGTGAGAAGTTCGGGGTCAGCCGAGAAGGCCGAAGAtggccaagatgaaggcAATGATATGCAAAGCAAGACCCACTTATACGCGATTCAA
GGTAGATCCGCGACAATTACCCATATTCTTCGCGCCATCAAGCTTGACGGCAAAGGCGGATTATCTCAAACGATTATGGATGATATTTATGCCATTTCTG
AGGAACTTGTCGAGAGTCAGTTCCTCAACGAATGTGCGGATAGTATCTGGCTCACCTGCACGCGTGCTGGTTGGACGCTGGTGGGAAGTCTTGTGGCCAT
GAACGACGAACAGTGGATTAAGGCGAATTTGGAGAAGCTCCTGAACCTGTGGCTGAAGTCCAGTGTACTTCACAACCGTGAATCATctcttgagctcctg
cgGATCGAGGCCGCTGTAATTGCCCTGAGCAGCTTCTTATCCAATTGCCGGAGTGCCACCATAGACTCTGACAATGATGTAAATATTCTTGCCAgtcacg
tgctgcacgtaTATTTGACGGCAACACAGGATACTCTGAGCAACCCACTCAAGCGTCGCGGCCAAATTGCTCGGTACCGTCTTATGGGACGGATCATCAA
CTGTTTCTCGATGCTACCACCGATTTACAGTGATTCGTATATCGTACTGTTGGATCTGGTTGCTGAATCCACCACCGCGCAGGCGCTGACAAACCTCAGG
CATTCTTCCCTGGTACCGGCGAAATCCACGTACCTGCAGAGCGTGCTTTCTTCTGAAGATGACACGCTTGACGTGGTAACCCTCTCACGATTGGAACCAG
GAGATTACCCATCCCCGCTATACTCAAGGGAGCTCAATCATGTGCTCGGTTTGCAGCAACGGGAAAACGCGTTGACAGATACCGAACTCGAGGTACAATA
TCTCGACACGTTTTGGAGATCGATGGCTGGAAAAGAAGCTGTGGATGGTGTGGTCAAGCAAACGAGTTGCAGTCCGTTTACTTACGTTCGGCTTGTGGAC
GCCAGCGTGTTTCTGTTTGGTCGACTTTTCCACTTCATTCCGGAAGATCTACAGCTTCGATGCCTTCAACACTATGCAGGAGCTCTGTCCGACGTTCGAG
CTGATTGCGAAGTAAATGTGTGTTCGCTATTGTTTGCGGTAATTGCAGAAGCCCAGCGTCTGGAAAAATCTGGGTCCGCACCAacttcgtcagcgtcgct
TTCTGCAACATCGTGGCCTCTTCAAATGCAAACCATGCTGTGTGAAATGATCTCGAGTGAAAACGCGGAAGttcgtcgtggtgctggcgaaGCGCTAGGA
ACTCTGGCGCTGATTCTTGGGGAAGACCATTGCAAGGGACTGATTATTGAGTTGGAAAAACGTTTGGTGGTGGACAAGCTCCCACAAGGAGCTACTAACG
TCGCATTTGGCTCCAATGCTGACCTGGATGTGTCTATTCTGTCAGCTGGTGCCGCTTTTGCGTTAACATGCATCAAGCGTGTTTGTGGCTCACGCATCTC
CATTGACACAGGCCTCATTTTTCGGTTTGCGGGTGAATGTTCTCAGCCTCTGCGTACGTGGATCTTACACTCATGGGGCATTATTTTGGAATCCGTCAAT
TCTACAGGAGGCGACTACGAGCAATTTGTGACCTCAACGTTTTCTCTCCTGGAGGCCCATGTACTGGCTGGTTTCGTCTATTCAAAGGTCAATAAGCGCG
GGCTGCGGTGGCAAATAAGCACAAAAGTAGCACTTGGGCAGATTATTAACGATGTGGTGGCAACGCTCGGCCCAGAGCTTGGCGGTTCAAGTGATCGCTT
GAACGAATTCTACTCCTACTGGATGTTTCTTCGTCAGGATGGTGACGCTCGTGTCGAGCTGGAGTTTTTGAGGTTTCTGGAGCAAGTGGTCGTGTTCGCA
CCGTCTCGCTTTCAGTCTGCAGATTTGCGATACATATTGCGCATAATATCTGATACCGCTCTGCTGAACTCTTCAGCTCCATCGTCGCTCGCACCACAAC
AGAACGCGGGACCCCCAATTTTGTCGCCGCCATCAGGGACCGGTCCGTCGCTGGCGACTCTGGGAAACTTTGGCGAGCCATTCGAGCAAAACGGCCTCGT
GAACGTTGGTGTATATACAAATGGGTGGAGTCGGAGTATCCTGCAAAACGTCGGTTTGTCCTGCATTCGCACGCTGGTGGAAAGGGAACCGACATTGATT
CGCCGCCAGAACCTGTTTTGTCTTCTGTTTTCGGCGCTTCACGTTGAGTACAACGCGCTTACGTGGAGCTACTTGCCTGGGCTACACGGCATGCGGGACG
TGCTCTCCTTTGCTTTTGCTGACTCGACAACCATACAGCGGAACAGTATTAAAGTGCTCCAGAGCACAGCACTGGCGCTACTGGACATTGAAGGCAGAGA
CCACGAAGGCGCAGAACCGTGCCTCTGGGCTCTGTTGTGTCGCAGTATTGCTATCGGCGAATCAGCTAGTACCTTTGCTGGAGCTAATGCGGAAGAACTC
ATGATGAGCCCGAAAGGAATGAACGCCGGTATTCAAGTTGCAGCAAACGCCGAAACTTCagaggatgacgacgcaTCGTTTTGGTCACCAAATCGAGGCT
TGGGCGTACCAAAGATTGACGCGAGTTCACTTGCATCTGCGGCTGTTGCTGCCCAGGTGAACACGTGGCGAGCTACAAAAGCAAGCGTCGGTGATCTCAT
TGCGTTAATGCCACCGCTTTCACGCCAAGTACGCCACTTCGCGGTGGAAtgcgtgctgcgtgtgtTTGAACTGATGGCGGCGATCCCACCAATGACGACT
GGAGTGTGTCAGAACAAGCAACTCCATTTTGATCTCGCTGCGGCCCGCCGCTATTTCTTCGAAGCGCTCTCTGCTGGGGCAGCATTGCCCGTGTCCGCCG
AGTCCAACATCGGGAATTTCCTGTGCATGTACTTGGACGAGTTTGTGACCCTCGCGTGCCACGTTACTACGACTTCAGCTGAAGGGGACGAGCTCTTAAT
GTTCCAGTGCGTCGGTCTCCGTCTGCTGAATGTGCTGGTGAAAAACTTTGCGTCGGCGCGTGACCCAGAAGTGGCCACGGGTGATGCTTACCTGTTGGAC
CCGTACCGTGCACAGCTTTCGTCCGCTATCCGACATGCTCTGAAGCAGGTACAAGTGGAGCCTTCATCGTTAACTCCAAGTTTGGACAAAGACAAGAGTG
AGGAAAGCTACTTCTACGCGCCGCTACTTCTTGAGACGCATGCCATCGCGGGTGCCTGCATCTCCGCTCATCTCATTCAAGATAAGGTGGGATTGGGACG
TATCCTCAGAGCAGTTGTGACTCCCGATTATGGCCATGCTCATTTCATTGGAGACGAACTCACCCGTGCTTCACTTTCGCTTGCTAACTTGGCGTCTGTG
GGAGAACTGCTATCGTCAAGTGTCACGGAGGCGATTGCTCAAAACGATGCGCGCGACGATGAACGTCGAGCTGTCGCGGTATCTCCGCTCGTGAAGGTGA
TAACTAACAGCTTGTCGGAATCCTCAGAGTACTTGTTTAAGTGTTGGATGGATTCGACCTTTGCGTACGGTGTTGTTATGCAAGGCTGTGCGCAATGGGC
GCAGTTGGACGCAGCTTCAAGTGCGGCGTTAGTAAGTGACGAGGTGCTGGTTATGCCAGCTCTACAAATGCCACTCCCACCGatcggtgctgctgcggac
gctccagcagctgctttGTCAACCTCCAAAGCCCTGCGCACGCTTTACAAGCGGTACTGGCCAAAGATCGTCCATGCGATGGCAACACTGGAAGTCTACT
TGCCGAAGTCGGTTTCTCTTTGCAGCAACCAAGAAGGCAACATTCCGAAGTGGTCATCCGTCCTGCTGTCCAGTGCGATCTTCCATGTCAATGCGAACGC
TCGCGATCGAATGGAGGACGAGGGGGAGCTGCCAGCCGTTCTCCGCAGTATCCCGTTGCTACTGAGAGCATTGGTGAACGACCCACTCAAACAAGGTTGC
TCTTCATCCAGCAACTTCCCACTGCTCTTGACAACTGCGCTGAACACGCTAATGATTGCAAGTAAACGGTGTTCAGGCCCAGCTCAAATTGAGGCTCTGA
ACGCAATGTTCGCATGCTTATCGCGCGAGAATCTAGCATTTGCTCGAGAGGTGTGTCGCTCTGGAGACGATGGAGAACAGCGCTCTGCTGCACTTTTCGA
GAGTGTAGCGCAGGCTGGGCTGTGCCCAACAGAAGTAGTTTGCCAACTATGCGACGCAACTGAGCAGACCCGGCACGCTCGAGCAGTGAGCATCGGAAGC
AGAACCACGGGATCCCGTCGCACTTCTGTCGCAAGTGTCGAGGACTCCAAGCACATGACTGAAATCGTGCAGTTTGCTACAACTGGTATTGTGCTTCTGC
ACACGACCGAAGAAGCGCGGCATGGTGTGGTGCACTCGGTGGCCATGGTACAGCAGGCCATTTGTTCTGTCGCTGGTGGCTACCATTCTTCCGCTGTTAA
GGACGCTGTGGTAACGCTTAACCGTGCTTCCACCGAGTCGGTCCTTGCGCTGGCACGCACGCTTGAAGGAAATAATGATTCGACTGATGGCGTCTTAACC
CGTATCAAGTCGAGTGTACGCAGCTGCTTCGAGTTCCTCGCCGAATGGCTAAAGGTAGACATCCACACTGCTCCCAGTTTTTCGATGCAGATTGCTACAA
ATTATGCTGTACGTTTCCCGGTTTGCCTTCAAGACGATGCGAAACGTTTCCATGCTGACGTGGCAGAAACAACTTCGGCGATGCTAGAGGAGCATACTAT
GCTCGGAGGCGAAGACGAGAATATTGTGAAgcagcaacgtgctgcttccAGTGCAGAGCTTCTGCGAGGTTTGCACGCAGTCGTGAAAAGGCTCGTCGAC
GTGTGCCAACCCTCCATTTTGAATCGGTATCTAATGGCGCTCGGTCCGTCTGTCGTCGAGATTGTAGGAGCAACAAACGGCTACCCAGTGACACCTgccg
agctcgctgagctggatGAAGCAGAAGGACTCCTTCGCGTGCTGACGAAGCAGTTGAGCGACCAGCATGGCTCCGCGTTTGTGCATATGCTGCTCCCGAG
ACTTGCGGCTGTACTCAGCCATCCGGCACCGTCAGCTGCAGACAACACGATTCCGGCACAAGTCCCCGGTATCCTGGCGCGATTGCTTCTGTGCTTTGCG
CAGACCCACGCCGCTGCGTTCAAGGAAGCCGTGGCGGCCATGACCCCCGCGTGGCGTGGTGTGCTGGAAACTGCGCTGCGACTTGCTCTCACCGGCTCGG
ttccagccgctggagcACGCGGACAGCCGTCATATCCGCAGGGTAGCAGTCCTGCCGCCACGCTTGACCTAAGTCGATACAACTAA