Transcript Name :
Phypl_g14
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
DnaJ domain1.4PR00625
DnaJ domain1.4PR00625
DnaJ domain1.4PR00625
DnaJ domain1.4PR00625
Profile scan predictionP-Valprediction_id
DnaJ domain18.638PS50076
Zinc finger, C2H29.91PS50157
HmmSmart predictionP-Valprediction_id
DnaJ domain4.8SM00271
Zinc finger, U1-type4.6SM00451
Zinc finger, C2H2-like0.008SM00355
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, C2H2-likeIPR015880
DnaJ domainIPR001623
*** None ***
InsideOutsideTMhelix
1-458
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
zinc ion bindingGO:0008270IEA
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        1446 bases(100 bases per row)
ATGCGCTGCCACTACGAGGTGCTGACCGTTGCGCGggacgcgtcggcggcggagatcaagaaggcgttccggctgcaggcgctgcggTGGCACCCGGACA
AGCACCGTCAGAGCGGCATCTCGAGCGAGGAGGCCACGGAGCAGTTCCAGACCATCCAGAGCGCCTACGAGGTGCTGAGCGACCCACACGAGAAGAAATG
GTACGACGAGCACCGCGAGCAGATTTTgcgcggcggagacggcaacgaggacgacgagggtgaggacgagctcaaccTGTTCCGGTACTTCAGCGCGTCG
GTCTATTCGGGCTTCGGCTCGGACGAGGGGAGCTTCTACTCCGTGTACGGAGAGCTCTTCGCCAAGGTGCGTTGGCTGCAGCTTAATGCAGTGCCTCTCG
CGGTGCAGTACTGATCATTTTATTGTGTGGAACAGATCGACGGGCTCGATCTGGAAGGCGGCGATAGTTCGAGGTCTGTGGTTGCGCCAGAGCTCGGAGA
TGCTAAGACGTCCATGGACGGCGTCAACTACTTCTACCAGCACTGGAAGAGCTACACGACGCAGCGCAGCTTTGCGTGGGTGGACGAGTACAAGACGACG
GATGCACCGACGAGACTGGTGAGGCgagcgatggagaaggagaacaagaagctgcgggATGCTGCTAAGAAGGCGTTTACTACTGAagtgcgcgagctcg
tggacttcgTGTGTCGCCGTGACCCGCGTGTACGAACGTTCCAGAAGCGAAAGGAGCAGGAAAAGGAGCAACGGCGTCTTGAGGAAGAGGCTAAGAAACG
CGCGAAGCAGGCCGCGTACGGTGCCGAGCGACGTGCCTttcaggagcagcaggagaagctctgggctgacagcagcatggaGACCAGCCGTGTTGCTGAC
CGAGATATCGAGCAGGAACTCGAGAGGCTCCGAAAGAAAATGGATGTGCACGTGCTTGTGTGTGACCTGTGCAACAAGACTTTCAAGTCGACGAAGCAGT
TGCAGAACCACCTCACGTCGAAAAAGCATcgtgagaaggaggaggagctcggTGTGTTTAGCGACCTCAGCATTTTGGATGACGAGATGGATAGAGCACT
GCAGGAGGAGCTTATCACTCTTGGCAAGGTCACGCCTAAAACGAGCGATGATAATGACGCTCCTGTCCAGCCGTCCACAGAAGACCAGAACGATGCGGGG
GATGTCGATgctgagcagcaggaagctgacgaagaagctgcgcgtcAGAAGGCAGAGGCTGAGAATTTGAGACTTGAAAAAGAGCAGAAGGCAGCTGAGA
AGCGCCGGGAGCGCAAGGAGTtgcgcaagaacaagaagaaggaaaaCGTAGAGAAGATCGTTACCAGTGCGCGCTCGAAAAAAGAGAAGAAAGACGAGGA
GGATGGACAGCGTGGTCGTGggaagaagggcaagacgCGACGATAG