Transcript Name :
Phypl_g7
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_309454
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-894
NN-scoreoddsWeighted Score
0.5981.6320.003
*** None ***
TypeScore
nuclear304
GO
*** None ***
*** None ***
*** None ***
Sequence
        3292 bases(100 bases per row)
ATgttcgcgcagctcaagcgcgagagtctgcgcaagctgcaggcggtggaGGACAAGAGTCCCAAGGGCTGCATCGACGAACCCATCGTGGACATGATCA
AAACCATCAACGCGCATCCGGATTACgtgggttgctgctggttggcaCATGCTCCAATGGACTTGTGCTCACTCTccaagttttttttttttttacacag
gtgacgagcagctcgtgctcggggCGCATTGCGGTTTTCTGCGGGGAAGCTGCAACGGGCAATGGAAATGAAAGCGGCACGGACCTGATCACCAAAGGCG
GCAAGTGGCTGGTCGCTGAACACGCCACCATCACGCTTGACCAATTGGTGGCGGCGTTACGCTCGCCCGACgccaactccagcaccagcaacatAGTACG
TCGTTGCGAGCTTCCTATTACCGGTAAAGGTTATAGTTGTTTGTCGCTAATTCTGTGGGGTTTATGCTTTGCGGTAGATTATCTTCAAGCACGAGCCGTT
TATCATGCACGTGGTGTGTCACGATCTGGACGCGGCGAaggagttgctgcagtgggGCATCGCGAGCGGGTTCCGCGAATCGGGTGTCGTGCTGGGCAAC
CGAAAGGTTATGTGCGCGATTCGTACGACGGCTAACGGATTGGAGATCCCGCTTGGACGGAGTGCGGAGCACTTGCTGGTCGACGAGGAATACCTCCGGT
GGGTCGTGGACATCGCGAACCAGAAGTTtgaggccaacaagcgcaaGACAGATCGACTTTTCGACGCCTTCCGCACGAAATTTTGCCAACCGGCAGCGAA
CGCGAAAACTGCAAGCGGTTCTGTTGAATTGGGCTCCTGGACGGAAGTGGCAAGTGAAGACAGCGTCAAGCTTGTGGGACATACGAGCGTGCAGTACCAG
GATGAGATTGTGGTATTTGGTGGCCAGGGACCTATTGCGTCCGGAACGACAACTCGTGTTGCCGAGGTGACTTTCTTGACCCCTTTCAAGAACGGTTCCC
TTCAGCAGACCTACCATGCGGCGGCCAAGTCTGATGGCCCGTTGGCGCGGACGTATCATTCAGCAGCTGTTGTGGGAACTCTTATGGTTGTGTTTGGTGG
TCGCGCTAGCCCCGCAAAGCCCTTGGGTGACCTCTATGCTATGGATCTTGAGACGAAGCAGTGGGAGAAGATTGTTCCGCAAGGAGTTGGCCCCTCTCCG
CGTTGGAAGCATTGCAGCTGTGCTGGTACGTTTTTCTTACCAGATACTGGTTGATGGTTAGTAATTATGGAGCGGAGCACTAACCACGGGTTGTTTCTTG
CTTTGACTACAGTTGGCTCTGTTCTCTACGTGTACGGTGGTCGTGATGCTGAGCAAGCCTTTGGTGATCTGTTTTCCCTGGATCTTAGCCAAACCCCGCC
GCAGTGGCGTCAAATTGGTACGCTTCATCAGTCTCCAAAGCAGTGCTTCCTTTTTGCGTGTATTAACGAGATATTCATTTGCAGAGAGTTCGCCCACTGC
CCCATGTCGATTTGATCACATTGGTGCAGTTGTCAAATCAACGAAACTTGCGTTTTGGGGAGGCATGTCGTCACTAGAGGGCGgtgactgcagcagcgaa
aATGATAGTGGCGTTTGCTTACTATTCGATACTGTCAAGGAGACCTGGGAACACAAGAGTCTCGAAAACACCAGAAACAAAAGCCAGCCCCCCGCACTTT
TtgctgccagcgcttcctcgatCAACGACCACCAGGTAATTGTCGTGGGTGGCATGACGTCTGCGTTGCTTGCGAATGGAGATAAGGCGACCCAAAAGGT
GTACGTGCTGGATGTCGAAACTTCTCAGTGGATAGAGCTTGGTGAAGTGAAGCACGAGAATGCAGCATTTGTGGGACACAGTACGACGTGGATGCCGACC
AGCGATTCTCTATACGTTTTGGGCGGTGGCTTCCAATGCTTTGGCTTTGGGCAGTTTTATTCGTCAACGTATCGGTGCCACCTATCGGTAGCGGCACCGA
AGCAAGCCCCTGGCGTTGCTACCAAGAGTAAGCTGGCCTACACGCGTACTACGCGTGTTTCAGCTTCCTCAGATGACAAGCCGCTTGGAATTCTTGTTGG
AAAGCTGCAagtgaagaaggtgaagacACTGCTGGAAAAGGCGCATGTGTACGACAAGTCTCGCCGTGTCCACATTGCAAACGTGGCGCAGTCGAATGAG
GCTACGACTGACGGAAAGCCAACAACGATGTTTTTGCTTCCTGTGGCAGCAACTATTCGTGAGTTGATTGCCTCGACGACCGATGCTGAATTGCAAAAGC
TCCAGGTAGTTACTGACGATGATGCGTACGCAAACAAATTCGGCAAGACGAGTGGGCTTAACCGCAACGAAGTGATCCGCAGTACAATTGGCGCATTTGC
TAGCAAGCACCAACTCTCGCCCGAGATCGTCAACGTGATTCCGGAGAAGTACGAGTTTGTGAGCGATGTTTTGTTGATCCCGCGCGACTCCTTCCTTGAA
CCGGAGTGGGCACCATTTGCTGACGAGATGTGGACACACGTGTGTGCATCCACTACACCCACGTTTGCTCGTGTTGCACGGAAGGCCTTTATCGATGCGA
ATGAGAAGCGTCAAAGTCATGTGGAGCTACTGTATGTAAACGAAAAGGCCCTTACCTCGCAGCGTAGCAAGGGGGCCCCTGGTTGGGTGGAGATTCGAGA
GAATGGCATCATCTACGGCTGGGACCTCACGCGAGTTATGTTCTCGTCGGGCAATGTCACTGAAAAGGCTCGCATGGCTAACATCGGATGCCGTGGTGAG
ACCATCGTCGACCTCTTTTGTGGCATCGGGTACTACGTTCTCCCCTTCCTCGTGCACGGCGGTGCGGCGTTTGTCCACGCTTGCGAGTGGAACCCGGACT
CGGTAGCAGCACTGCGCTTCAACCTCGAGCGCAACCATGTAGCAGACAGGTGCAAGGTATACCTCGGAGACAACCGCGAGTCGGCTCCAACAATCGGTGC
TGTGGCTGACCGTGTTAACCTGGGACTTTTGCCCACGAGTGAGAAGGCCTGGTCCTTGGCTGTGCAAGTCCTGAAGCCCAGCGGCGGCTGGTTCCACGTG
CACGACAATGTGGCAGTGGAGGACCGTGAAACGTgggagcagcacgtgctggactCGATGTGCAAGCTGGCAACGCAGTACGGCAAGCACTGGACCATCA
CGTGCGAGCACGTGGAGAAGGTTAAGTCGTACGCCCCCAAGGTGTATCACCTCGTAGCCGACATCCACTGCGTGCCCATTTCGCCAGCATAA