Transcript Name :
Phypl_g36
Orientation:
(-)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.520.65841
InsideOutsideTMhelix
1-20
129-237
303-317
397-402
450-461
44-105
261-279
341-376
423-426
485-1035
21-43
106-128
238-260
280-302
318-340
377-396
403-422
427-449
462-484
NN-scoreoddsWeighted Score
0.7923.4860.007
*** None ***
TypeScore
endoplasmic reticulum435
GO
*** None ***
*** None ***
*** None ***
Sequence
        3108 bases(100 bases per row)
ATGGggctgctctgctgcgccgccaagtgctgcggctgcatggcgctctcgcagctctgcgcgctgctgctgccgctgggcATCCTGGCCGCGCTCGGCC
TGCTCTTCTACACGTACGCGATCCCGTGGGGCGAGGACCAGATCCGCCAGGCGCTCAACCTCGCGTCCGACGTTGACATCGGCGACCTCAACGCCAGCTA
CATCGAGGCCCACAGCTGCTCCGGCTGCGTCTTCGGCAGCAACACGCAGTGGCCCACCAACTCCACGGGCACGAGGCACTTCCTGGACTCGGAGGccggc
agcacggcgtcgggcGTCATCGCCATATCCTTGGCTGGCGCGGCAGTGGTCGGTGCCGGCTCGATGCTCTGGGCCTCGGTCGTGCCCAGCGTTGCTGCGG
CGCTCAGCTTCTCCGGAGGCTTCTACGAGATGACGCACATTGTCGAGCAGGCCCAGTTCGCAGGCATGATCAGCCAGCTGAGAATTGAAGGCGCACCCGC
TtttctgctgcagttctCCAAGGAGCTCTCGTGGACGAACTTTAATTTGATCAAGggaagcagcggcgactccagcagcagtgggaACGACCGAAGACTG
GCAGATTCCAGTTCCAGTGCCACGGGAGCTGTGGCTGCGGCTGGACAGTCCGGACCGGCGAGATATGCCGCGCTGATCGGCGTGGATGCCGACGACCTCT
TCTTCTACACGCTCGTGTCGTTTGTCGTAGTGCTCGCagtgctgcacgcgctgtACGTGGTGATCGTCCTGATCATGGGTGCACTAGCCAAGAACGAGTC
GTTCGGAGATGTGGCGCGCAAATGGTATCGCAAGGTTGTCTGGGCCGGTGTGctggctctgctgctggcgcagtaCATGTTCGCTATGGCTGGAAGTTAC
TTCGTTTCGAAGGGATCGTCGAATGACTCGGCGAGTGGCTCCAGCTCACGTTTCGCACTGGGTATTGTCGCTCTTGCGGCAGTTGTGCTCTTGGCCCTTG
GACTCGGTATCATCGTTGTTGGCAATAACACCGACGAACTCAAGGACGTGGGGACTTTCGAACACGACCAGCGGacgttcagcagcaagtacAGCGCCTA
CTACGACGAGTACAACTTCGACaaccgcttcttcttcgtgcctCGCATTCTGCTGGCAGTGTTGACTGGTGCTATCGTTGGCGTTGTTCGGGATGCCACG
ACTCAATTGCTGTGCATCTTGGCCATCACGATGGTGTACTTGatcttgctgctcctccgtcaGCCAAACCTGCTGCGGTTCTTGTACTACATCGGTATCA
CGTCGGTCTTCATGAAGGTGGTGCTTATCTCCCTCATGCTCATCGTGGCCAGAGATGACTACTTCCCTCAGACCGTTCGCGACAACGTAGCCTACGGCAT
TATCGGCGTCAACATGTTCATCTTctttttgctgttcgtgcgCCAGGCGTACACGATCATCCACAAGATGGTCGTCGCCTGCCGTcacaagaagaacggc
aaggAAAACTCCAGCCTGGACGCCACCGACATCAATCTCGAGTTTGGGAACAACACGTCCACTAATCGCCCCGCGTACGAGCAAGTGGAGTCCACGCCAG
CAGGCCGCGGTGCGGACTGGTACGCaaacaagcagcagcaagagctaCAGCGTAAccagcagtaccagcagtaccagcagcaacagccgcAGTATCAGTC
GCAGACTAGCGCTATGTCCGGTTACAGCACCACTCAGAGCTCCCGCAGTGGCCACTCCGAGAACGTGCCCATGCTGGAGCCGGCCCCGGAACCTGTACCA
GTCTTCAGTCGCTCTCGGGGCAAGATTCGCCCACCAGTTTCCCGTAACCAGCAGTACTCGTTTGGAGGCTCGTCGCGAGACCCAGATGCGTTTGAAGTGA
ATAACGtcgcgccagctcctccggcTCCTACTGCTGAACCTGCTCAGGAACCCCCAACATACGACGTGCTGGCAGCCTACCTAGGCACGAACAATACGAC
TGACGAGACTGCACACTTGACCTCTCCCAAATCAGGCAGAGGTCAATCGTCCAGGGGTCAGCATTCGTCAAGAGGACAGAATTCATCTCGGGGCCAGAAT
TCATCGCGAGAACAGAACTCTTCGAGGGGTCTTGCATCATCAAGAGACCCGCCGTCATCGGGAGGTCTGTCGTCGAGAGGAGGAACTGCCGTTGCTGGTA
TGTCCGGATCTGGTGTTGGCTCGCGTCCTTCGACGGTGCCGCTCGACGCGTACGCTGAAAGTTTCTCCGGCGTAGACTCGGGCatcagcacgacgtcgtc
gcggaGGATAcgcagcttcgtcatggATTCTCTGCGCAAGGATGTGACTATCGATGACATGGATATCGATGTGGACGACGACTTTGCGGCTGGGCCTCCT
GCACAGTCGACGGCACGTCAGCAGTTCAACCCCGGCGCATCGACCGTGGGTCAGCATCACTTTAACCCCGCTGCTTCATCGGCCAGCTCGTATGCTATGA
TGGATCAGTCTTACGTGAACTTCTCGGACTCGGCGGTATCCACTGCCAGCGGCCAGGCGGTCATGATGCAGAGCCCCGCGAAGCAGGACAACACGTTCTC
AGCTGCTAtgggtgctgctgccccccACCCGAGCAAAAGCGGTGGCTTCGGTAGCAGTCCTCAGGCCAAGAtgtcgatcttctcgaacggTTCCGACAAC
AGCTTCGACGGtgacagcagcggctggtTCAAGCAGCGGTCGAAGACCGTGGTGAGTACGGACGAGGATGGCAGCGAAGCCCGCGATGTGGAAGGTCAGA
GCTATGAACTCGGCCCTCTCGGCGTGACCAAGTCCGCCTTTTCTCGCGACTCGATGGACTCGTACGGGTACCAGTCGACTATCAACTTCGCGACATCTCG
CGTGGACTTCAACGCTCAGAGTCAAATCACCGAcaacggcagcgacgatgggAAGTATTACCCGACACACCGACGACGCACAGGCTCCTCGAACCAGTCG
CCGAACCAGTCGTTCCTGAGCGCGCACTCCGATGACAGTGCATCGTACTACGACGTGGATAAAGTTCGCCACGACCACAACGACGACCCCAACACCCTGA
CGCTCTAA