Transcript Name :
Phypl_g25
Orientation:
(-)
Number of Exons:
8
Description :
conserved hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6070.73622
InsideOutsideTMhelix
1-532
NN-scoreoddsWeighted Score
0.6151.5350.003
*** None ***
TypeScore
extracellular, including cell wall556
GO
*** None ***
*** None ***
*** None ***
Sequence
        3377 bases(100 bases per row)
ATGCGGAGCGTGTTCGCTGGCGTGAtggccgccgtggcgttgagcagcacgctgtGTGCGGCTGCGCCCAAGGTCGACATCATGATCATCTCTCGTCCGC
GGCCAGAAGAGGAGGTGCCGCCAGTGCTGACCCCCATCCCGTCCCGCGATCCATTCCCAGCATTCCAAGGCATGTTGTGATGGCACGAAGGATAATTTAT
TGCTACACATCTAACAACAATGGCTCGTGTGGTCCTATTGTGCGTTGCAGGTCCATTTGTCGACAacctcgagtcgctgccTTGTGTTCGGGAGGAGCGG
GAGATGCAGGAGGGCAAAGCGTGAGTGTCATATGCTCTTCCGACACTTTTTATCCCGATCTCATCGAGCGCTATTGCAGCTATATCCTGGACTTGTGCCT
TCTAGCCAACGTGACGATTGAAGCCAAGATCGATCTGAGGGTGGAAGTGGAGGTTGAAGTGACGGAGGGCGTGCCGGAAGCTCCCAGTACGATGGAGGAT
GGTGACGATGAAACTGCAAAGCTCGAAGACCCAGTGTccgaagagaaggaggagccAGAGATTCCCACTATACTCGGGTAACAGGCTTGCTATTACGTGC
GTAGTTGGTGTGAAGATCGCTCATTGGTTTGATTGGTGGTTGACGCATTTGCAGCATTTTCCGCGGCTGGAAGATCGACCCTATCACGCTCAACTACAAG
TACATGGTCTACGACGACGGTGGCAATTGCATGGACAACGATCATTACTCCAtgatggtggagctggtTCCTTCCAGTAACCCAGAGTCGGACACGAAAT
TGTATGGGCTGAAGAAAACTGGCATGTGCACGTTCAAGGCGTCACTGCTTACCTACGTTCCGGAGGAAGACCGACTTGCTGGCCAAGGAATCCATACGCC
CGGTGTGGTGGATATTAGCGACGCGGAGGCGTCCTTGCCAGTAATATGTGGCAAGATGAAGTGCCGCTACGGGGATATCTCAAAGCGTGTCCGAGATTTG
TCGGACCAGGTACTGCATGAACCGATGCAATCCCAATATTGTCGATGCAAGGCTGTAGCTAATATCTTCGATAATTGCTCGTATGCTCAGATCCGCGATG
TCCAGGCCACGATGGCAAAGGGATCCGTTAACGCGAACACGCTGTTTACCAACATGACTCTGGAAGCATCAAAGAACACGCTAGAGTCAGCCACGCAAAT
CCTCGAGAAATcactcgagctcttccacgAAATTGAGGACCTGCAGCGGTCTTTGACCAACGATTTTCTTGGACGAGAAGacgcggcgaagaaggagatt
gcagagcaagaagcggaGGACAAAAAGAGGGAAGCGGAGAAGCAAGCTACTACCGCTACTGATAATCCGGCTGAAGAGCAGgatgctgctcatgctgtcG
AAAAGCAGGACCAAGTGACAGCAGAGAGCTGATCAGCAAGCATTTGAAGCGGAGGAATACACGAATTTCGCCGTTCCTGTTTttcgttcttcttcaaggt
GTGATGTGGTGTAGTATTGTTTTCTAGCCAAAAAAAGACTGCCGATTTTACGATATTAGGCAGTCGGCATGGAGCACTTAGGGCCATGGCGATGGGATGA
TCCGTACTCCTTGCACCAACCCAAAGGAGTGGAACCGCAAAGCGCGGCACTTTCACTTCGTCAAGAGATGCTGAAGAACGAGTTGTTGCGAACGCGTCAA
CAGCAGCTGATAGAGGTTAGGAGGAAGAACCGGGAGGAACTGAGGTATCGAGCAAtcctgtttttttttttttctcgcGTGGTCCGACATCGCTCCTGCT
TGAGATTTAATTGGGTCGTGTGTTGCAGAGCTCAAGTGCAGCGACTAGAGCACCAGGTTCGCGATTATGAGGTGCGTCTAGGCTGAAACCTATTGCATAT
TGTCACCTTTTAGCATACTCACGAAGGCATCCCTGAAACTGTTGATAGCTCAAGGCGTCTAGCCCAGCCAGCGGCGTTGATCCCGCTCATAGTAATGACT
CCTGGACCAGTTATGCCAGCATGGATGCAACCGTGCCTACCACACAATACGAACAGCGACTCCCGCGATCAAGTGAAACTTTGGTTGAGAAATTGGTGCA
TCAAAACGAGCAGATCATGGCACTACTTCTTCCCCGACGTCAGTAGGTATTCCTGAAAACGACTGTGCGGTAGATTTCAGTGTCGTGCATGTGTGAGGCT
AACTACTGCATTTCCTTGCGCTGAAGTGACGATGCGGACACAACGAAGGGCACATCAAGAGAACGTTCGGACAaatcgccatcgccttcaATTGCTCCCA
GCAAGACAGAAGAGGATAAGCCCAACACATCAGTACAACACGATATACAAAAAGAAACGCCGGCTAAGAAGCTTACGCCAACGTTTCAGGCCCCAAGTGC
ACTGCCATGGCTTCCTGAGGTCGAGTGGACAGATGAAGATGAACTGGTACGCAACTTTGCCGTTGATGAACCTCATCCTTCGTCACCTGAACTGTTTGTT
TAGGCACTCGACAGACTTGAGAACGACTCCAATACTCTTCCTGATATCCGAGGAAGCGACGAAGTGAAAACCAATAAGAATGCGCAGGAAACCGATGCTT
CTTTGAACACGGCTACTACGAAAGCTGGCGCATCAAAAGACCAGAAAGCACGCGACCGCCTCGAGAGCCGTAAAAGGCTGGAGGCGCTACTTAGTGCCTC
ACTTAAAAACGCAGCCGGATCCACCTTGAGGAAACCGAGGTGGCGACTTGAAGCTGAGGCCGAAAGCGATGATGTCTCGCCCTTCGAACCGGAGGATGCA
GAGGTGATGGAGCCTCTTCCAGTCTTCCGCTCCGCCGTACTATCCATCTTATACACGGTGCACCTCAAGAAAATGTTGTtggagaagaagttggcAGAAA
AGGAAAGCGTGATGCGGGTACGCTTTGTTTCCTGGTTTACGGATTACCTCGCTTTTCTACTAACAGCTGCTGTAGGACTTTGATTCCATGTTGCGTGTTT
ACTTTGATGCCACTCGTATGTGGTTAGGAAAGGTGGTAAGAACGCCGTTGCTGTCTTTACTTCAGGACTCCACCTTGGACTTGGATATCAGCACTAGAAA
TGGCCGTGGTGGGTCGAGTCTGCGAGGTTTTGCTAAGAAGTTTGGTGGCATCCttgctcgccgtcctcctccaccagcacaaTCGTTTGCCAGCAATGGG
CAGTCACGTGAGAGTGCCGTGGATCCGACGAAGCTGCTAAAACTGAAAGTGCGTACGCGAGGGCTTTTGCAGGCACTTAGCAAGGCGATCGATAAGAAGG
AGGTGCCCACTGGAATCTTGGACTTCTGGAAAAGGATTTCTACCGATGGTGTTTACTTCCCGCCCAGTGTGCGTTAG