Transcript Name :
Phypl_g39
Orientation:
(-)
Number of Exons:
8
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Cyclic nucleotide-binding domain17.645PS50042
Cyclic nucleotide-binding domain12.484PS50042
HmmSmart predictionP-Valprediction_id
Cyclic nucleotide-binding domain1.4SM00100
Cyclic nucleotide-binding domain1.4SM00100
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclic nucleotide-binding domainIPR000595
*** None ***
InsideOutsideTMhelix
1-433
NN-scoreoddsWeighted Score
0.6361.8010.004
*** None ***
TypeScore
mitochondrial435
GO
*** None ***
*** None ***
*** None ***
Sequence
        2071 bases(100 bases per row)
ATGtacgtgtgtgtgtgtgttgcgTCAATTGCATTGCCTTCGACCAGTGACTCACTTTTGATCCTCGCCAGGCTATCGAAGAGGGCGAGTTGGCAGAAGC
AGCCCGACCACGAGCTGTTCGAAGTGCGTGCCAACTTGCGACGgattctgctgctggccgaggctGCGAGGTGCAAGGCCGACTACGACTTCCTCGAGAA
CTACAGTGCGCTGCTGAGTTTCGCCTAAACGTGCGTTATGTGTGCACTGATACTGCGTTGTTTGCCGTGCAGTCCACCGCGTCAAATACTTCCGCGAGCT
GCCGTCGAGAGATCGactgcgcttcttgaaggcGGCCAAAGgcatcgagctcgacgatggagacgctcTCTTTCGGATCGGCGACCGCGCGGACGCGTTC
TACTGCATCATGTACGGTACCATGAGTGTGGTCATGGACTTTTCGCGTATGGCAGCTCCCACGCtgaacgagttcgaggagatCATGAACCGCGCCCGCG
TGCACTCGAGCTTCCTGAATCCGGGCGGCAAGCTCGATATGTCACACGATGCTACGTACGTCGTCCGGACCATGAAGCCACTGGAGGTATTCGGCGACGT
CGgtttgctgcttgaagaacagcagcgtaCGGCTTCTGTTGTGGCCACGGAGACGACGTTACTCATGCAGATTGATCGTGATACGttcatggcgctgcgc
gCATGCAACCTATCACGAGAACTCCGGTATGTGTTGGTGTCATCTGTGTACCAATGAGCTCAATCTAACCACGCTTTCCCTTTTTATTGTTGTTAGTGAG
AAAATGACCTTCTTGGCGGGCGTAGCGTGCTTGGATCATTGGGAGGACGAAGCCATCTTAAAGCTATGCGACCGAATGGAGAAGATCCAGCACACATACA
ACgatgttgtcgtcgttgaggGCGAACCTGCAAGTATGTCAAGTTGATGGTCGATCATTTGTTTGCTATTGGTTTTGATCGGTGTTTGCTCACTCTGCAA
TCGAGTAGATAATTTCTACTTCGTCAAACATGGTGAGTGCAGGCTTGTCAAGCGGTACAAATGTTCGGCTCTCGAGCAGAAAAAGAAGCAACACGATCGC
AAGCAGCCGTACTTTGTTGAAATATCCACCATCTGCAGGTAATGATGAACATCAATTGAcacgcccccccccctaaCAACGACTACCCTACAATTCTGTG
CGCAGTCAACACTATTTCGGCTTTTACGAAGCAATCCTGGGTGTGACCAACGCGGTGTTTTCTGTACTCGTATCTTCACCCTCGGCCATTCTGTACCGTG
TCGACCGCGTAGATTTCCGACAAATTATACTGAAAGATGCGACTACAGAGCAAATGCTGCGTCAGGAAGTCATTGGTCTCTCTGCGCGAGCCGATACTAC
CAGCGTCCTGCGTGACTTGAAGCGCGAAACCAAGTGGAACCAGTACAAGCAAGAGTTGGTGGGCTCTGTTCTCACTAGACACGACGAAGAACACATTCCC
ATCATGGGGCCGCGGCCAGACCTCGGTGGGTATCGCTCAGCTCGCGAGCCAAACTTTTGTCTGCCAAAACTACCAACGTCACCATCTTCCAATAGAGGTT
CACAAACCGAACGAGGGGTTCCAGGTGTCTCCTCTGGTCAGCTCCGACGGGCCCAAAAACCACTAATCGCCAAACCCAAGCCATCTCCACGCCGTTCGCG
TGGAAACGATGCCAGTTGGCTCAGTGTAAGTGAGGTGATctcattttttttatttgaGCGCCTAACGCTCCTGGTTTCGTGCAGTGGGCACAACAACGCG
CCGGAAGCGGCGACAATATGAGTCCGGATGGCCGGGGCCACGCTGACAACAAGAATGAACAGGTAACTGGTGAACTCGTAGGAACCCTGTCACCAGTTCG
CGGCATTCGGTTAACGGCGACATTGGACACTAACTTGAAACGCGTGGCTGCTTGCAGGCGCTCGTTAGCAACGTCCAGTGGGGTAAGTCCTCGCAGATCA
TGGGCGGGCTTCGCAACAACGAGGACAAGGTCTCCACGGTTATAGTTGAACTCTTCAAGACAAAGCACTAG