Transcript Name :
Phypl_g31
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_472892
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
F-box domain11.908PS50181
MATH12.822PS50144
Zinc finger, ZZ-type13.018PS50135
HmmSmart predictionP-Valprediction_id
F-box domain2.9SM00256
MATH7.1SM00061
Zinc finger, ZZ-type2.9SM00291
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-655
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        2335 bases(100 bases per row)
aTGGTCGCGTCGGCGCGCTCGCTCAGCCCCAAGAAGCGCCAGTGGCTCGGCCAGAGCGCCAGCAGacgcgccaagcagcacccGCGGCTGGTCCAGTGCC
GCGCCAGCGAGGGCTCCGCGGGCGAGACGGACTGCGAGAGCCTGAGcccggacgacgacgtggacatggaCGAGAATGCCGAGACGTTCGCCAGCGACAT
CCGGACGCTgccggacgagctgctggccctggcgctcgcgcagctggacggccgctcgctgctggcgtgcgCCGCGACGTGCCGCACCTTCCGCGCGCTG
ACGTTCGACCGCGAGGTCTGGAAGAGACTCTGCGTCAAACAGTGGGCGACGCTGAGGACGCAAGTGCTGCCACAATTGCCTGGCGCCCCGGACTATGACG
TACGAAAGAAAATGCAGTCTTTTTAGAAGGTGGGAGAGAATTGGGGGCTGAGTTATGGCTACTTTTGTGTTGTGTGCAGCTTGTGAGGCTCTACGgaggc
tgctggaggcgctgcttCGTGGAGAGACATGCCAAGGAACAGAGAGCAGAGATTTCGGTCAAGGTGCCCAAGTTTTCCGACGTGGAAGCCATGGGAGACG
GGGACAAAGTGTTGTCGGACACGTTCACCATCGGCTCCCATCACTTCTGCCTCTGGGTCTTTCCTAACGGCAACCCCAACGAGGCTCAGTACAAGGGCCG
TGTGCTCAGCGTGTACCTCGTACTCACTGATCTGTCACGGCGTCCTCCGGACTGGCTCACGTGCGCCGTGTTCTCGCTGCAGGTGGAAAATGCACTGGAC
CCGAGACGTCGGCTCGAGTGGCACTCGTGTCTGACGGACAACAAGTTCCACAAACATCTCAATAATTGGGGCGTGCATTCGCTTGGATCGCTTAATCTGC
TGCGCGACCCTCAGCAAGGCTTCCTAACGAGCTCAGCCGAGGGTCAAACGCAACCAGATACTCTCACTGTGTCGGCTCAGGTTCGCCTGATGTCCATTAC
GTTTCGCGTGGTGTTTGAGCACGATCTTCGAGAACACCATCAGCTGGGTCTCGTAGACTTCTCAAATGTGGTGGAGCTAGAGCTGCCGTTCTGCTGCTCA
CTGCGCGATCTGCTTGTTGCACTGCACGATCAGTTTCCCGAAGTACTCGGAGATTACAGTGAAGAGGATGCCGCTACGAACAAGACGCGGGTGTGGTGCT
TCAATCAGCCGGTGGTGTCAGGGCAGGCGCTGCGGCCGCGCAAATTGCTCACGTGCGACATATCTCAGCAAGAACGACCGCTTTTCGGGCACTTACTTTG
CGACGGCGTAGACATTGACGCTTACTCGTTCTGCCAGATTTACGTCGAAAACAGCTCGGTGGCGGATGATCTTCCTCTGGATCTACCTTCAGGCGATCTA
GCGAAAGAATTATTGGCGACACCGGAAGGATATGTTTTTGTAAAGCTACTGCAGCCAGCCCCTGCCAATCGCCTAGAGTACGTGGGCAAAATTCGTGTAC
TTGAAGCATCATCACCCGGAGGCACGGATATGCAGCACAAGCCTGAAAGTGGGAAGCTGGCACCCAGTGTATTGTACGAGGCTGTCGCACGCCATACAGG
TGTAAGCTGCGCGCAGTTGGAGATGTACCGAGAGGAAATCGCCCCCACTGTTGTTTCTAAGTTGATCCCGTATCATGCGTCGAGTGAAAAGGCGAGATTG
CGGCCTGCAGATATTGTGATATTTTGCATTCGATCACACTTTCCTCACGGGCTTTCTCCAATGAGTTCTCTCGATCCAGTCTcggggctgctgcttgaac
gCTATGCAGAAGCCCACGAACTCTTCAACCCCAATGAATTGGTACCACCCACGCTAGAACAGGTTGAAAACTTGGCTGAGAAGTTGGACATCCCGAAATT
CCGCGTGCGCAGTGCCTTTCGCAAGTGTCACGAGGACGCGCTTGCTACCTTGCGCTACATCATGGAGGGCCGTCACCTGGGTTTCATCTGCGACTCGTGC
GGCGAAACAGATTTTACCGGAGCACGATTCAACTGCGCTGTCTGCAGTGATTACGATTTGTGCGCTGCGTGCAATGGTAGGTACCACTGCGCGTACCATG
CCCATGCTAGGATCTGACCATCTGAACTAACCATTAATGTCTTGGTCCTGAAGCAGCGCAATCGTGCGAGATCTCGCACCGCTATGCCAACGTCGACGGT
AGGTGGCAGCGCGTGTACAATTTCAAGGACCACAAAACCTTGCACACCATGCGCAAAATGCTGCCGGTTTTCTATGGATACGATCGCAAGCACCAGTGGC
AGCAGGCAGTTGAGAGCGATTGCTGCAATcactga