Transcript Name :
Phypl_g26
Orientation:
(+)
Number of Exons:
5
Description :
hypothetical protein PITG_03758
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-710
NN-scoreoddsWeighted Score
0.531.1910.002
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
*** None ***
Sequence
        3497 bases(100 bases per row)
atgctggaggaagGCGCATCTGTCATCCTGACTCGCGTGGAGAATGCGAcggagcttctcggccgtCAACAAGTGTCGACGGAGGATATTGCGGCCCTAA
ACCAAGTCTTAGAGGGGCTTCAACACATTGTTGCAGGTTTCGGCTCCCAGCGGGTCCTGGAGCTGTCGGGTACGCGGATGATGAACGCTGGTGTGGAACT
GTACAAcgcgccgcgagctgctctcAGGGTTCTCGCGCAagtggagaaggccaagcagcaaggTGACGGTCAGCCGACGAGGTTCCCACGGTATGCGCTG
GCAGTCACGCGGTTCGTAGCAGCGAAGATCATGGGGCTGTCTCTGGTTTGCTCCAAAGACGGTGGGGTCCAGGAGAAGGGCGGGAAGAAGAACTTGCAGT
TCATGGACGAGTgcgtcgacgtgctgcgctcgtTTGGTCGAGTGGGCATGCTCATGATGGAGAGCGCGTCGATTGACTGTGAAAGGTGTGAGGAATactt
ggcgctggcgaaggaatcattttcttcttcaatgCAGCTGTGGTCTCGCATCGGGCTCTCTCATCTAGCGAAGTTCAAGCAAggcttggagctggaggac
gttGTGGACGATTTGTGGGATTTCTGCGTGGACCGAGTACGAGTGCTTCGCTTGCTGGCAGAGCGTTCTGACAATTCATCAGAAGAATTTCGAGATATTG
TATCATCCCTACATGAGTTGAAGATGCTGGCTCCATACAAGACTTCGTATGCAAGCAGTTTGCTTGATGTTATGAAGAGTGTGAGCGATGGATACCGCCG
TGCGgcccaccacgagctgcaaaTGGCAttcgcagaagaagcgctgcGTGTCGGCGACTCGCTTGAAAATGATGCCGACGAAAACTTTCCGGGGTTGATT
ACGTCGTTTAAGCAGCACGTGTTAGTGAATTTACTGCAGGCACTCTGCACTTCTGGAGATATTGAACGAGCTGAAACGTGCTACCAGCTGATTCCAGCCA
ACCAAGACTCCAAAGTATTGCTGCTCATGAACAAGCTCTTCGTTGACAGCAAGCAATTTGAGAAAGCGCATCGCTTGCTTCAACTATTGTTTCAGCAGGA
TTGCTTCGACGACTCTATCATAGGAGCCCGCACCTTTGCGCAAGGATTATCCTTCTCCGACAAAGGCTTGGATATTTATCGAGAGCTTGCCGACAGTTAT
GGGGATGCCGACTTCGCCATCAATTTGGATGTCGCATGCAACCTCGCTTTTGTCGAGGGCAAGCAATACGAAGCTatggacgagctcaagcgcattGGAT
GTGCTTTGCTAGAAGACGAGCGGTATGAGTCCACGAATACTCGGAAAGGTATGGCTGTCTCATTTTACAGTGTATGCTACAGGGGTGACCAAGCAGTAGA
TACCAGACACATTCTACGGGTTCGACAGACCATTTTTGACGCTCTTCAGCACACGCTGAATTCTAACCAGCACGAGGTAAGTTGCTCAAATATCAGGGGT
ATTGTACAAGGGCAATATTCACTCGTTTGTGATATCATAGGACTGCTTGAAGTGGGCTGATGCTGGTTTGGCTACCGTTTCAACACCACGAGAAAAAGCG
ATGTACAAGAGGTAACCAACCGTGGCTTTAGCTGTACTATTATACAAATAATTTGACCCCAATGATACTCTGCAGGATCATGTCTCGCTCGTTCCTCCAG
CTGGGCCGTGATGCTGAAGCTTTACATTGGGCTGAAAAGGCTTTTGCTACAGAGCCTTCCAAGCAATCTCTGCTTGCTGTGTTCCAAGTAGCACTTGAAG
CAAAACCTGAAGTCTCAGAGGAAGAATTGGTGCGAATCATGGAGAAGTTAAAAGCTAGAGATGACTTTGAGATTGAAGATTTACTCGCAATGGGAAAGCT
AGCCAGCAATCTTGGTTCATCGAGACAAGATGTTTTGCTGCACATTCTGGATGAGCTGTGCCATATTCTCGGTCAAACCGACGGCAATCCAACAAAGGTT
CCTGTGGCTGTAGTGCTACAAAATGCCGCGCAACTGGCCTTTAGCAACTtcactcagcagcaacaagccgGAGATAATTCAGAAAATTTCTACGGCGAGA
AATTCCTGACGTACGCGAACGCGCTActgttgaagttgtcggaAGCCGACACAATCGATCATAAAGAAAGTTTCGGGCCTGCTTCGGTCTTCGAGTGGTT
CTTTCGGATGAGGTAGGAGCTCGCGATTGTCTTCACACATTTTTTGCGGACTCTGATAAATGCTACTCGATCTTTGTGACAGCTTTGACATCGCCAAAAG
CACCGAAGACTCCACATATTTTATCGTGGCAGCCAATATAGCAGAACGGAGCAACGAATTATACGCGGAAAACTCCCCACTCTTGCAGCGATACCAGCAA
TGTTTGGTGGCTGCAGTAAGCTCCAACATGAAGAAAATCGAGACATTGGATAAGAGCCAACTCCACGGGCTTCTCGAAGTGATCAGCCGGATCGGATGCT
TTGAGAGTGGAGATAcagctgttgctgccgaaGTCATGTGCTACTTGGTACGGAACGCCTTATACTGCAGCAAAGAGCAGTGATTTTCACCAAATTGATT
TCTTGTTGATAGGCGAGGGCAGTGATAGCGGTGAAATTGAGACTCTTAGACGCAAATACAAAGGCGATTCTTGATCTTTGCAAGGCGACACAGCACAGGG
CTCCTGAGCTCATGGAGATTGGAGGTAGGTCATACCCAGATAACAACCATAGCTTCGTGATTTCACTCATGTTTGTCCTACCCTGCAGAGTTAGTGCTGT
ACGCGACGAGATTCAACGAAGCGTCCGAGGTAAGTCTTGTTCGGACTGGCATTACaaatgccccccccccctcagTTGGTTTACTTGAGTAGGTTCGAGA
CAGCTATCGATCTTTAGCCGGAGAAATATTCAGCTACGGGTACGACCTATAAACCATTGACGGCACGCACTCATTTGCACTAAAAGAATATCGAAAAATG
TAAAGAATACAAATGCTGGTCCAAGAGGGATCGATAGACTCGAGCAAGCTGTGCTATCTGCTACGACGAGTTATCACGCTGGCGGAATCGAAGCCAAAAG
CACACGAGTGGTTCGAGCAACTACTTCAGGTCATTGACAATTTGGACCTAACGATTTCGGAGTCCGACATGGAGTGGTTTGTCGCGAAGGCGTGGAACAT
TGTGCGTACCTTCGACTTCTATGAAGATCCAAAATGTCTCTACTAACCGAAGCACATTTTAGGGAGTGCTCTGCCATCGAGGGAATAATACTGAAGAAGC
TCTCCAGTTCATGAAAACTGCTCAGGTTATAATGCGTAAGTGGCATACATGACCCTTCTCGCCATTTAGAGAACTCACCCATGTCTTTTGGTTGTGTAGA
TCACAGTGAGCAGCTCATGGAAAAGCTAGGCGATGGACTCGATCAGCAGTACCAGGAGATTCTCAGAATGAGCGTCAACTCGGCACTCAACGGCTAA