Transcript Name :
Phypl_g17
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_552366
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-277
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K02926
*** None ***
Sequence
        913 bases(100 bases per row)
ATGGCGACTGTGTGTATGAACCGactgctgcgcggcgtggcAGCGCTGGGCGTGTCTGCTCCGCGCGCGAGTctggcgcgcgcggccagcacgcagGCGG
CCGCGGGGCCGGCCAACCTgtcgctggccgaggagaagctgatgccgccgccgcgcgtgATCCCGGTGGCGCAGGAGGTCAAGGTGACGCCGTCgggcga
cctggagctgcagctgctgtcgatgacCGAGGGCGCGCAGGGCCTGGACTCCGTCACCATGGACGGCGAGGTGTTCGGCGCGCCCAACCGCGTGGAcatc
ctgcagcgcgtggtgcgcTGGCAGCTGGCGTGCCGCCGCGCCGGCACCAACAAGACCAAGACGCGCTCCGAGGTGAGCGGCTCCACGCGCAAGCCGTGGA
AGCAGAAAGGCTCGGGCCGCGCCCGCGTGGGCGACATCCGCGCGCCGCAGTGGCGCGGAGGCTACCGCGTGCACGGCCccgtgctgcgcgacttctCGTA
CAGCCTACCCAAGAAGGTGCGCGCCATGGGTCtgcgcgtggcgctgtccACCAAGCTCCGTGAGGGCAagctggccgtcgtggactcgCTGGACGTTGAC
GTACGTAGCGGTTGCAAGCTTGCCGAGTGGGGTGGCGAGTGGGTGCTGACAAGGTGATGGATGTTGTTGCTGCGAGCAGGTTACCAAGACGAAGGAtatg
aagaagctgctgggcggccgTGGATGGGACCACGCGCTGTTCGTGGGCGGCGAGGAGGTGGAGTcgagcttcgtgctggccacgcgcaACATCCCGTACG
TGGACACGATGCCGCAGAACAAGATCAACGTCTACTCGATCCTGCAGAAGGACCTGCTGATCATCACGAAGGACGCCGTCAAGTACCTTGAGGAGCGTCT
TCACGTCGACTAG