Transcript Name :
Phypl_g47
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_552331
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pyruvate carboxyltransferase41.433PS50991
HmmSmart predictionP-Valprediction_id
2-isopropylmalate synthase LeuA, allosteric (dimerisation) domain1.2SM00917
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-576
NN-scoreoddsWeighted Score
0.5783.1350.006
*** None ***
TypeScore
mitochondrial913
GO
Biological ProcessGO IDPrediction Method
catalytic activityGO:0003824IEA
leucine biosynthetic processGO:0009098IEA
KO ID
K01649
K01649
K01649
K01649
*** None ***
Sequence
        1731 bases(100 bases per row)
ATGATGCAGACGATCGCCAAGCGCTCGGCCTCCGCGGCCAGGGCCAACGCGCGCCGCGCCTTCTCGAACGCGGCTGCCGCCGAGGCCGGCAAGGACCGCC
TCGTGATCTTCGACACCACGCTGCGCGACGGTGAGCAGTCGCCCGGCGCCACGCTCAacttcaaggagaagctggacatCGCGCGCGGCCTGagcgcgct
gggcgtggacgtgtGCGAGGCGGGCTTCCCCATCTCGTCGCCCGGCGACTTCAACGCCGTGTCGGCCATCGCCAAGGAGATCGGCCCGATCACGGCGAAC
CGCCCCTCTGGCGTGCCCATGACCATTTGTGGTCTTGCGCGCGCCATGGAGAAGGACATCCAGCGCTGCtacgacgccgtcaagcACGCGCCCAAGCACC
GCATCCACACGTTCCTGGCCACGTCCGACATCCACCTCAAGTACAAGCTCAAGATCTCGCGCGACGAGTGCATCCGTcgcgccgtggacgccgtcaagTT
CGCCAAGAGCCTGACCTCGGACGTTGAGTTCTCCACGGAGGACGCTGGGCGCAGTGATCCCGACTTCCTGTGCGAGGTCCTCGCCGAGGTCATCAAGGCC
GGCGCCACCACGCTCAACGTCCCCGACACGGTCGGCTACACCGTCCCGGGCGAGTACGGATCGCTCTTCCGCTACCTGATCGACAACACGGAGGGCAGCG
ACAAGGCTATCTTCTCCACGCACTGCCACAACGACCTGGGTCTTGCGACGGCCAACACCCTGTCCGCTGTGCAGGGCGGCGCGCGTCAGGTGGAAGTTAC
CATCAACGGTATCGGTGAGCGCGCCGGTAACACGGCtctcgaggagctggtgatGGCTCTGAAGACTCGCCCGCAGCACTTCCCCGTGTACACGAGCGTG
GACTCGACGCAGATCACCCGTTGCAGCCGTATGGTCAGCCACTACACTGGTATGTCTATCCAGCCCAACAAGGCCATTGTGGGATCGAACGCCTTTGCTC
ACGAGTCTGGTATCCACCAGGATGGTGTCTTGAAGCACCAGGCCACGTACGAGATCATGCTGCCTGAGTCGGTTGGTCTCAGCGAGAACAAGATGGTGCT
CGGCAAGCACTCTGGTCGTCACGCGTACAGCaagcgcctccagcagcttggctACGCCAACCTCACCCCGGAGGAGCTCGACTACTACGTGGAGAAGTTC
AAAGTGCTGGCtgacgagaagaagacggtcACGGACGCGGACATGGAGGCGATTGTTTCGGATGAGCTGTTCAAGCCCGAGGTCTTCTGGACCCTGCAGT
CCGTGCACGTCACTGCTGGCAACCTCGTGAAGCCGACGGCCACGGTCACGCTTGCGCACAAGGACGGCCAGGAGGTGAGCGAGGCCGCGATGGGTACTGG
TCCGATTGACGCCATCTACGTGGCCATCAAGCGCGCTACGGGCATGGAGAGCATCAAGCTGAACGACTTCTCCGTGGAGAGTGTGACGGATGGCACGTAC
GCTCTGGGTGAGGTGACCGTGCGGGTgcaggaggacaaggaggaggaggagaagaccgaggacgagaagcacGTGAACGCGCAGACGGGTGTCACGCGTG
ACCGCCAGTTCGTCGGCCATGGTGCTAACACGGATATCCTGGTGGCGTCGGCTACTGCTTACGTGAACGCCGTGAACCGCATGATGGCATCGCAGGcgcg
tgctgttgctgaggCTCGGGTGGACGCCTAA