Transcript Name :
Phypl_g21
Orientation:
(-)
Number of Exons:
1
Description :
polyribonucleotide nucleotidyltransferase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
K Homology domain, type 113.523PS50084
Ribosomal protein S1, RNA-binding domain13.092PS50126
HmmSmart predictionP-Valprediction_id
K Homology domain1.5SM00322
RNA-binding domain, S11.3SM00316
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
RNA-binding domain, S1IPR022967
*** None ***
InsideOutsideTMhelix
1-914
NN-scoreoddsWeighted Score
0.5071.1210.002
*** None ***
TypeScore
mitochondrial565
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
KO ID
K00962
K00962
K00962
*** None ***
Sequence
        2745 bases(100 bases per row)
ATGCtgtccgccgccgctcgtcgcCTGCcggccgcggccgtggcccgccgcgccgccatcTCAGCCGCTCACCAGCGCGTGCCTCGCGTCAGTGGTGTCG
CGCCGCAGTCCCGCGCGTTCCTGGGgctgcgcgacctgctgttcggcgccaagaagccgtcggaggaggaggaggccgccaagaccctcgcagcgcagca
gcagtcggagCCGACAGAGCCCAAGCAGGGCCACAaccagccccagcagcccaaggaggaggagcaaCGGGTGGTCGGCAGCTCGGACGCCACGTCCTAC
GCCGTGGGCaagctcgccaagctcgcggacgGTGCCATTCTGGCCTCGTGCGGCCGctccgtgctgctcacgacCGTCGTGAGCGGCAGCCACAACGGCA
ACCCGTCGGCCAGTGGCGGCTCGGTCCAGCGCGACTTCCTGCCGCTCACCGTGGACTTCCGCGTCAAGTCGTACGCGGTGGGGCTCATCCCGGACAACCA
GAAGCGCCGCGAGTTcaccggcagcgacgaggaggtgctgcagtcccGCGTGGTGGACCGCGCCATCCGCCCGCTCTTCCCGCGTGACTACTGCGAGGAc
acgcaggtgctggcgacCGTGCAGTCCTATGACCCCAACAACGACccgctcgtggtggcggtcAACTCGGCGTCCGCGGCGCTGAGCATGTCGGACATCC
CGTGGAACGGACCGGTTGGCTGTgtgcgcgtggtggaggTCGATGGCCACTTTGTGGTCAATCCCACTGCTCCGCAGCGTGACGCTGCTACGCTGGATGT
GCTGTACGCTGGTACGGCGGAGCGTGCCATTATGGTGGAAGCCTCGGGCGACGAAGTGACCGAGGCGCGTCTTGACGAGGCACTGGATCTGGCGCAAGCA
AACGTACTGCCGGCTATtgaggagcagaagaagctggtggcggagcaTGGCAAGAGGAAGCGCGTGTACTCGCCGCTGTTTATCGCACCGGAGGTCTGGG
CCAAGGCGAAGGAGCTTGGCAGCGCGGACGCTGAGGCGTTGATCGCTAGTGGTCATGTTGGTAAGCTCGCTCGCCAGCAGGGAGAGCGCGGGGTCTACGG
CAAGATGCTGAACGGCATGCGTCAGCACTTTGCTACTGCGAATCCTCCTGTTGACGATGCTGCCATCCAGCGCGCGGCTCACGACACGTTccagcgtgtg
ctgcgcGAACGCATTCTGACAGTTgcgaaggagacgaagaagaacaagccCGTGCGCCTTGATGGCCGACCGGTTCGCATCGTGCGCCCGCTAGAGATGG
ATGCTGGTGTGCTGCCGATGGCCCACGGTTCGTCTCTTTTTGCTCGAGGTgagacgcagacgctgtGTTCCGTGACGCTGGGGCCTCTGGAGCGTGGCAT
TCGTCTTCGTGGTGCTCTGAATGAGGCGCGCGAGCAGGCTGAGCCCAGTGCCCCTGCGCCGCTTAAAAATGCTATGCTGCACTACGAGTTCCCGCCGTTC
TGTGTGAACGAGACCGGTCGTGTGGGTGGAACCAACCGACGTATGATCGGCCACGGTGCTTTGGCTGAGAAGGCCGTGCTGCCTATTCTGCCGTCGATCA
CCGAGTTCCCGTACACTGTCCGCATGACCTCGGAGGTGGTGGGCTCGGACGGCTCGTCGTCTATGGCTACGGTGTGCGGAGtctcgctggcgctcatggA
CGCCGGTGTTCCAGTTCGCCGCGCCGTTGCAGGCATCGCCATCGGTCTTGTTACTGCCGGCGACCCTTTTGCTGGCCAGGAGAAGCGCATTGAGGAGGGC
GACTACCAGTTGGTGACTGACATCCTTGGATCGGAGGACCACTACGGTGATATGGACTTCAAGGTGGCGGGCACGACGTCTGGTGTGACGGCACTGCAAC
TGGATGTGAAACTCCCCGGTGGCGTACCGCTTTCCGTGTTGAAGGAGGGACTGCGCGAAGCCAAGCAGGCCCGTCTGCATGTGCTGCGTCGTATGAGCAG
CGAACTTGCTGAGCCGCGCGCGACCCTGAAGTCTAGTGGCAGCTCGCTGCCGAACGTGAGCATTGAGTGCATGATTCCCACCAACTTGATCGGAGCGTTG
ATCGGCGTCGGAGGCAGCAACATCCGCGACCTGGAATCGCGTTTCAACGTCGGCGTGAGCATCGTCGACCGTCGTGAAGGCATTGTGCGCGTCGTGGGTG
CGGCTGGCGATGCGGATAAGGCTCGTGACTGGCTGCAGACAGAACTGGCTGGCGTTGCCAACCCCCGtggcaacaacaacaacaacaagaacagcaacaa
caacgacaacggCAACGGTCGTGACAATGACCACCAGGGCTCCAACAAGGGCCGGTCGTTCTTTTTCCGTAAGGGTGAGCGCTACACCATGCGCGTGACG
CAGGTCATGGACTTTGGTGCCATCCTCGAGTCTTctgctggccagcgcggTTTCGTGCACATTTCGGAGATCTCGCGCGACAAGGTGAGCAACATCCACG
ACGCCGTGTCCGAGGGACAGGAGATGGAGTTCGAGTGCCTGCAGGACGGCGCTTCCGGCAAGATGTCGCGCcgtgtgctgctgggcgcggACGACAGTGA
GGATGCCTCGACTGCTTCCTCGGAGAAGTCAGACTCCACGACCCCGCGTGCGGGCCACCATCACACACGTCGACCGTCAACACCTTCGGGCGCGGCTAAG
CGTCGTCCGAAGACCGCTCGCCGCCCGCGTACTCAGTCCAAGTAG