Transcript Name :
Phypl_g30
Orientation:
(+)
Number of Exons:
2
Description :
protein kinase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phox homologous domain12.187PS50195
Protein kinase domain50.817PS50011
AGC-kinase, C-terminal16.953PS51285
HmmSmart predictionP-Valprediction_id
Phox homologous domain8.2SM00312
Serine/threonine- / dual specificity protein kinase, catalytic domain3.7SM00220
AGC-kinase, C-terminal2.4SM00133
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-734
NN-scoreoddsWeighted Score
0.541.3490.003
*** None ***
TypeScore
nuclear826
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein serine/threonine kinase activityGO:0004674IEA
protein bindingGO:0005515IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        2328 bases(100 bases per row)
ATGCCCGCGGTCGACGAGCACCCGCGCCGCCCGCCCCCGGACCCGCcggcgcgctcgcgctctgcggccggcagcggcaaccTCGGCGCGTCGTACCAGG
ACCCGCAGAcgcgcaagaagcgccagagcaacagcaagaagagcgcgcaGATGCGCCACTCGCTCACGCACGTGCAGGCCGACGCAGgccgctccagcgc
gtcgtcctaCACGTCCGGCTCGGCCCTGTCGCCGCCCGAGCGCGGCCCCAACTCCCTGAACATCCACACGACCGGCAGAGATCTGAGcccgcagcaccag
ctgcaccCCGAGTACCCGGCCGCGCCCCCCGCGGGCGACGACATCCTCAAGGTGGAGATCCCGCGCTGGAAGTCGAAGCTCACGACGGACCGGGCGGACC
GCGTGCACATCCCCGCGGGGGCCGACAGTGCCGGCAACTCGCCCGTGAACAGCGGAGCGGGGCGGTCCTCGACCTGGAACGGGAAAGATGGGCGAGGCGG
ACACGGAGGCTCCATGGGGGCGTTGGTGCTGGGGCGAGACCGggacagcggcagcaagaagcggTTCACGGTGTTCCAGGTCTACGTGCACTTCCAGTCG
GGCGCGATCCGCGTCTCGGAGAAGAGGTACAGCCACTTCCGGGAGCTGCACAAGACCCTGAGGAGGAAATACGCCACGGTGGGGAAGCTCTACTTCCCGC
CCAAGAAGTTCTTcatgtcgctgtcgctgcgcgTCATTGAACAGCGTCGAGAGGCCATCGAGACGTACATGAATGcggtgctgacgctgcgcCCGCGGCC
AGCGGAGGTTGTGCAGTTCCTGAACACTGGGAGCAGCTCCctcgagagcgaggaggaggaggacggcaaCAGCACGGACGGAGCGGCGCGCGGTGTGGAC
ATGGTCACGGCGCCGAAGCACGTGCAATCGACGGCTACAGCCCTGGCCACGTCTTCGCGGCTCAGTGCGAGCAACAGCTTTGCTTCGGAGGACGCGGGGG
GAAACATGGTGACCATGCAGGATTTCGAGATCCTTAAAATGCTTGGCAAGGGGTCATTTGGAAAGGTTTACATGGCTAGAGAGCGTGGAACGGAGGGCAA
GATCTACgccatgaaggtgctgcggaagtcggagctggtgaagcGCAACCAGGTGGGGCACACCATGATGGAGCGCAAGATCATGAGCTCGATTGACCAC
CCCTTCGTTGTCGGGCTCAAGTACTCGTTCCAGACGGCCAGCAAGCTCGTGATGATCTCGGACTattgctgcggcggcgagatCTTCTTCCATCTCAAGA
AGTTCCGCTCCTTCTCGGAGGCCATGGTGCGCTTTTACGccgcggagctggtggcggccatTGGCCACTTGCACGAGCGCGATATCATCTACAGGGACCT
CAAGCCCGAGAATATTCTTCTAGACGAGACGGGCCACGTGCGACTGACCGACTTTGGTCTCTCCAAAACGGACTGCACGGACTTTACAGGCGCCAAGACC
TTTTGCGGTACGCCCGAGTACTTGGCACCCGAGATGCTCATCagccgcaagaagaagacggagtACGGCAAGGCCATCGACTGGTGGAGTCTTGGTACGC
TCATGTATGAGATGCTCACGGGCTGGCCGCCTTTCTTCGACCGCAACATCGAGCAGATGTGCACCAAGATCATGAAGTCGCCGCTGAAGTTCCCTGCGCA
TTTTGGCCTCAGCTCTGAAGTCAAGAGTCTCATTTCAGCATTACTGGAACGCGACCCGACGTACCGCATCGGCTCGCGTcccggcgccggcgtcgagGAC
ATTAAGAACCACGTGTTCTTCGCCACCATCGACTGGAAGTTGCTAGAGAAACGCAGCATCAAGCCGCCCTTCAAGCCGCGTGTGCGCAGCCCGACGGACA
TCCAGAACTTCGACCGTGAGTTTACGAAGGAGTTGCCTGACCATGGTTTCTTGCAGCAGGACAAGCGTCTCGCCGTGTCGCCCAAAAACGAGTTCCAGGG
CTTTTCTTACACAAGGACGGAGGAGCCGGCGTCTTTTTCGCGTGAGTCAAGCAGCAAACGGGAGAAGCGCAGGTCAGGACGACGGTCGGAGCCAAGACTC
AGCGAAGGGTACGTACGAGGGAGGCATTGAAGCAGCGCTGGACGTCGAACTGGTCTACTGGGTCATCGTAGGGATCCCTGATTCTTGCTTCTTCTCTCTT
GCGTCTTGGGTTGGGCCTCGGGTGTTGCTAGAATCGAGCGCGAGTCCCAGTCAGCGGCAGATCAGCAGTATCCTGAATTCGGCCTTGTTGCCCGCGACAG
CACGGATTTCGACACTGGTTGTATCTAG