Transcript Name :
Phyra_g3891
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein AM588_10005190
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Glycoside hydrolase, family 3, N-terminal0.0000000000023PR00133
Glycoside hydrolase, family 3, N-terminal0.0000000000023PR00133
Glycoside hydrolase, family 3, N-terminal0.0000000000023PR00133
Glycoside hydrolase, family 3, N-terminal0.0000000000023PR00133
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-771
NN-scoreoddsWeighted Score
0.711.310.003
*** None ***
TypeScore
extracellular, including cell wall33.3
GO
Biological ProcessGO IDPrediction Method
hydrolase activity, hydrolyzing O-glycosyl compoundsGO:0004553IEA
carbohydrate metabolic processGO:0005975IEA
*** None ***
*** None ***
Sequence
        2365 bases(100 bases per row)
ATGCTCAAGTCGTGGTTCGCAGCAGTGCTGTGCACGGCCCTCGGCCTCGTCGTGCAGCAGGGCGCTCCGCTCGTTTCCGCAGACCAGTGGGATGAACGTG
CCGATGCCATTGTGGCCACCTTCACCGACGACGACATCATCGGGCAGATGACACAGATCGACATCAACCAGCTCCTCACGGAGGACAACAAGGTCGACGA
CGACAAGGTGCGCGCGTACGCCAAGATGCGCGTGGGCTCATACCTCACGAGTCCGTTCAACAACGGACCCGTGAACGGCACGTACATGTGGTCGGCAGAG
GAGTGGCGCGAGGTGGTCACAAGGATCCAGGACATCACCATGGAGGAGAACGGTGGCCACCCGATGGTGTACGGCGTCGACTCGGTGCACGGCGCCATCT
TCGTGAAGGACGCCGTGCTGTTCGGCCAGCAGATCAACGGCGGCGCTTCGTTCAACCCCGACCTTGTGTACGAACAGGGCCGCATCACGGGCCGCGACAC
GGAGGCATCGGGCGTACCATGGGTGTTCGGCCCCATTCTCGGCATCTCGCGCAACCCGCTGTGGGCCAGAACGTTTGAGACGTTCGGCGAGGACCCGCAC
CTGAACTCCATTATGGGCGACGCCATCATCCGCGGCCTGCAGAGCAACAACCACACGGCCGCTTGCATGAAACACTGGATAGTTTATCCTAAGACGCCTT
CGGGCCACGACAAGGACGCCGTGACGGTGTCGGACTACGACATGATGAACTACTTCTTCCCGCCCTTCAAGGCCGCCGTGGACGCCGGCGTGATCAGCGC
CATGGAGAACTACATCTCCATCAACGGCGTGCCCACCGTGTCGAACACCAAGCTCATGAACGCGCTGCTGCGCGACGACCTGGGCTTCGACGGCATGATG
GTGACGGACTACGCCGAGATCAACCAGCTGACCGACTTTCACCGCACCGCGCGCAACGAGACCGAGGCGACGCGCATCTCACTCACGCGCGCGTCCGTGG
ACATGAGCATGGTGGCGCAGGACACGAGCTTCTACAACGGCACGAAGGCGCTGCTGGAGCAGAGCCCGCAGTTCCGCGAGCGCCTCAAAGCGTCGGCCCG
CCGCGTGGTCAAGATGAAGCTGCAGTGGGTCTGTACGAGACGCCGGTGCCCGGGGAGGAGAACCTGGCACTCATCGGCAACGACGACGATATCTCGGCGG
CACTGGAGCTGGCGCGCGAGTCCATCGTGCTGCTGCAGAACAACGACAGCACGCTCCCTATCGCCGACGACGCGTCGGTGTTCCTCACGGGCTTCACTGC
CGACAACATCGGCCGCATGTGCGGCGGATGGACGATCGCGTGGCAGGGCTACAGCGACCAGGATCACCTTCTCACGAAGGGCATCACGGTCAAGTCGGCC
ATGGAGACGCTCGTCGGCAACGACAGCTTCGCCTTCTTCAACGGGTTGCACCCGAACGGGTCGTACTCGGAGGCGGACATGGCCACAGCCAAGGAGATGG
CTGGCAAGGCCGAGTACACCATCGCCGTGATCGGCGAAGACACGTACGCCGAGAAGCCTGGTGACATCGACGACTTGGCGTTGCCCGCCGGTCAGATTGA
ATACGTGAAGGAGCTGGCGTCCACGGGGACCAAGGTCATTCTGGTGCTGTTTGAGGGTCGTCCGCGTCTGCTCGGCGACCTCCCCGAGAACGTGCACGCC
GTGGTGAACGGCCTATTGGCCTGCGAACTGGGCGGCCAAGCCATGGCCGAGATCATCTACGGCAAGGTGAACCCGAGCGGCCGCATGCCGATCACGTACC
CGAAGGACCAGGCCAACATCCAGCTGACGTACAACCACCCCGTGACGAGCATGTGCCAGACGCAGGAGTCCAGCAGCGCCTACTACTGCGAGAACCAATG
GGACTTCGGCACGGGTCTCAGTTACACCGAGTTCTCCTACTCGGAGGTGCGTCTCAGCCGCAGCGTCGTGGAGGTCTCGACCGAGGACGTCGTGGTGTCT
GTGGACGTGACAAACTCTGGCAGCGTGGCCGGCAAAGAGACCGTGATGCTGTTCCTCATTCAGCCGTTCAACTCGCTGAACGTGCCGGAGATGAAGCAGC
TCAAGAAGTTCTCCAAGATCAGCCTCGAGCCCGGCCAGACGCAGAACGTCGAGTTCACGCTCACGGCGGATGACTGGAGCGTGTACTACCCGCAGGTGGG
CCACGGCCTCAAGAAGGTGGCCGAGGACTGCGACTTCGTGGTAGCCATCAAGCCGGAGACGGACTGCGACGTGTACAACGCGACGGCGCCGGCCAACCCG
CTGTGCGCGACGTTCTCGCTGAGCACGGGTGAGTACCCGTTCGGAACGTTCGATGAGCCGTGGTA