Transcript Name :
Phypl_g45
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_552333
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Cation-transporting P-type ATPase4.7PR00119
Cation-transporting P-type ATPase4.7PR00119
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
156-166
224-352
613-631
1325-1353
1424-1435
1498-1600
1-132
187-200
376-589
655-1301
1377-1400
1459-1477
133-155
167-186
201-223
353-375
590-612
632-654
1302-1324
1354-1376
1401-1423
1436-1458
1478-1497
NN-scoreoddsWeighted Score
0.6121.4910.003
*** None ***
TypeScore
endoplasmic reticulum667
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
cation transportGO:0006812IEA
*** None ***
*** None ***
Sequence
        4906 bases(100 bases per row)
ATGCGCGTCGCGTTCGCGGTGCCCTCGCCGTCCGACAGCTCGACGGACTACACGCTGGACATGCAGGCCCCCCCCGGATCGGCGGACGGCCCCTCCgcca
cgctgccgccgtcatCGCAGCCGCACTCGCACACGAAGAACCTGCGGCGCGTCAACACGTTCACGGGCGTGCccaacgaggaggagcagcgcaacaTCAT
CTCGCTGCGGTATCGCGCCGACAGGTACGCCTCAATTAGGTACCCCCTAGAACAAGCGTTTATTTAGGCACTAATCTTGTTTTCGACACGATGCTATTTT
CGACACGCTGGCTGCAATTTTCGACAGCATGGCGGACTCGGTGGCGTCCGACTCGAAGCCCAACGCGGAGACCAAGCTGTGGAACCTCTTCGAGCAGGTC
TTCTGCTTCCTCAAGGGCATGACCATCTACCAGACGCGGCGCCGCCTCAAGTTCACGATCGTGTCGCAGACCGTCATCAACTCGCTGCGTATCTTCCCCA
TCATCCTGGGGCTGAGCTTCCAGGCCACGTTGCCCGTGCTCATCCTGTACatcacgctcgtgctgggctgGCACGGCACCAAGTTCCTCGTGCCCAAGTT
CCTGCTCAGCTACAAGGTCGGCATGCAGCTcacgctgctcgtggacgtcATCTGGTACTACAAAGGCTACAACGGCAAGCTcaacagcgtcagcagcggc
acctcGGTGCTCATGCagggcttcttctccatcctGCTCACCATGCTCAACATCACGGGCTTCCTGTACGGCTGGAAGCTCCGCCGGATCGTCAAGGCCG
TGCAGAACCAGCGAGAGTGCGaccgcgcggcgctcgcgacGATGATGCCGTCTCCGCAGCGGGTCAACTCGCTCCACCAGACGCTGTCCATCAACCCGTC
GGccgagatggacgaggacgacggccCGTCGGCGCGCCGGAAAATTGTGGTGGGCCCGGGCATCCCAAACAACACGTTGCGACGCAGCCAGTCGGGCGTG
CCGGCGTCCTTGCCGGGGGCgctgaagaccaagaagcagcggaggaaggaggccgaggcgcaggaggaggcggccgtGTTCTGCTCCAACCTCATGGTCA
CGAGCAAGTACACGTACTACAACTTCCTGTTCGTCTTCCTCAAGATGCAGTTCAGCCGACTCGCGAACCTGTACACGACCATTGTGGTGGCGCTCTGTTT
CTTCGATTTTTCGCCCGTGAGCCCCGTGGCAAGTCTCACGCCGCTTCTGATCGTGTTCGCGACGTccgcgctcaaggacgtgAGCGAGGACCTCCGCCGA
CAGAAGGGAGATGCGCAGGTTAACTCGAGGACGGCGCATATTGTTCGTCGCGACGTTCTGGATGAGGTGATGCATATCGATGGCACGTGGCAGGATATTG
AAGTGGGCGACGTTCTGCTACTGAAGGACGGCGATCAGGTCCCCGCGGACTGCGTTCTGCTGGCCACGAGCCGACCCGATGGCAGGTGCTACGTTGAGAC
AGCCAATTTGGATGGCGAAACGAACCTGAAGATTCGACAGGTAGCCAGCTGCACGAAGCATTTCTTGACTGCGGAAGAGATCTTGGAGCGGCATAAGCTC
GAGGTGGAGTGCGATGTGCCCAACAAGGATCTGTTCTACTTTGACGGCGTGTTAAGGGTGGGAAATGTTGCAGACGACGCCGTGACGGATGCCAACAAGG
AAGACAACGAAACTAGTCTGACCATGGACAATTTGCTCCTGCGCGGCAGTGAAAGCCGCAACGCCGAGTGGACGCTTGGGCTTGTGATCTACACGGGCAA
GGAGACGAAGGTCCAGATGAACTCGGTCGCTGTGCCTCTCAAGCGCAGCTTTGTGGAGAAGACCTTGGATACCATGTTTGTGCTGGTtctgatgctgctg
ttcggaATTTCGATTGCCTGCACGCTAGGCAACAACAACTGGAACTTGGACCTggccgacgagaagacgcCGTGGTACATTCAGGAAGACTCAAACGGCT
ACATCTTCTTGAGTTACGTGATCCTGTTCAACAACTTGATCCCTCTCTCGATGTACGTGACGATGGAAGGCGTGCGCTTTGTTCACGCGCGTTACATCGA
AAACGATCTGGAAATGTATGATGCCAAGACAGATACACCAGCACAGGTCCgcaacagcaacatcaaCGAAGATCTCGGACAGATTCAGTACATTTTCTCG
GACAAGACAGGTACACTCACATGCAACGAGATGATCTTCGCAAAGTGCACCATTGCGGGTCTCCGCTACAACGACATTGAAGTGGATCCTGCGAAGCCGG
AAAGATCAGGCACACGGTTTAACGATGGCCGCTTGCTAGCGCGACTGAACTCGAACCACTCGACGAAAAAGGAGATCCacgacttcctgctgctgcttac
AATTTGCAACACCGTGATCCCAGAGACCAACGTTCCTGCGTCGCCTAAGTCAAGTAGTGACTCCAGCTCGGCCCAAAGTCCTCCGATCAAGTACAACGCG
TCTTCCCCAGACGAAGAGGCACTTGTTCAGGCCGCTGCCGATCTCGGCTACGTGCTCGAGTCGCGTGACGGCCCAATGTGCAACGCGCTTATCCAAGGCA
GACCCATGTCGTTTGAAATTCTGAATGTGCTGGAGTTTAACAGCGACAGGAAACGGATGTCTGTCCTCGTGCGATTCCCCGACGGAAGTATCGTGCTCTA
CTGCAAGGGCGCTGATGACGTAATTTTCGACCTGCTGTCGAAGACGCAGCCGCAGGGTGTAGCGCACGTGACGCGCGGACACCTACAGGAGTATGCATCG
GAGGGTCTTCGAACTCTGACGACTGCTATGCGTCGCCTTACGCAGGAGGAGTATGACCAGTGGAACCAATTGTACCGCCAGGCAGAGTTTTCCATGGAGG
GTCGTGCTTCCAAGATTGCCAAGGTTTCGGCCATTATTGAGGTCGAGTTGACTTTGCTCGGTGCGACGGCCATTGAAGACCGGTTGCAGGACGGTGTGGA
GGAGTCCATTTGTGCCCTACGCAAGGCCGGCATAAAGTTCTGGGTGCTCACGGGTGACAAGAAGGAAACTGCGCTCAGCATTGGTATGTCGTCGCATGTG
ATTGATGATAACATGGATGTGATCGTGTTGGGCCAACGCGACAAGGGTTCTCTGCGTACAAGGCTAGAGGAGCTGTATGTCGACCTCGTAGAGGACAAGT
GGGGGTCAGATGAAACATCATCGGCGGTTAGTGTGCTGTGGGAAGCCCTGAAGCGAGCAATCTTGTACTTGTGGGATCTCGTTAAATTGGCTCTGGTGGG
tcgtgacgaagaagcggaGTCTCGAAAGAAGCGGAGGCGCCTGCCTCGCCGTGAGCACGCCGGCGCTGATGCGACGCCAACGGATAGCCCTGCTCACTAC
GACGAGGTGTATCCGGCTCTACCCAACCGTGACATTTCTGAGAACAGCTTTGACCGAGATCTGTGTGACCACGACTTTGAGCCGAAAACCGATACGATGG
CAGGCGGTACGGGCAGCATGAGCAGTGGTGACTACATTGACGAGGAGTTGGAGTTTGCCATGGTGATTGATGGCAAGACTCTTGcactggtgctggacga
cgacatcaagTACCTCTTCTTGGCAGTGGCTACGCAATGCAAATCTGTGatttgctgtcgctgctcgcctTCCCAAAAGGCGTCTGTGGTCAAGCTTGTT
ACGGAACCTACGCTCATGTTCTCACCAGGCAATATTACGCTTGCCATTGGTGACGGTGCCAATGATGTACCAATGATTCAGGCTGCGAACGTTGGTGTCG
GAATCAGTGGCAAAgaaggccgccaagctgTCCTCTCCAGTGACTATTCCATTGCTGAGTTCCACTATCTgaagcgcctgctgctggtgcacggCAACTA
CAGCTACAAGAGGATTTCTAAGCTTATCTTGTTCTCGTTCATGAAGAACGTGGCATTGTCGATGtccaacttcttcttggcgatggagacaATGTACAGT
GGTTTGCTGATGTATttcagcatcttcttcacgctgtACAACGCGCTGTTCACGACGATCCCGATCGTCGTCATTGCCATGTACAATCAGGACGTGTCTC
CTGCAGTGCTGATGCAGTACCCTACGCTGTATGTGAACGGTCTGAAGAACCGGTCGTTTAACTGGCTGTCCTTTTTCGGCTGGTGTGTGCTGGGTGCGTG
GCACGCTTACGTGGTTTACGCAgtgccgttcttctcgaaCGGTTCGATCGTCTGGTACTTCTCGAGTAACTCGTCGAAGCTTCAGTTTGACAAGCGCGAT
CTGGGCCTCTGGGCGAACGGTGTCGCATCGTACACGTACCTGATTACCGCCTCAACGGTGCAAGTGTCGCTCATGACGAGCAACTGGACTCGAGCAAACG
TCGTTTCAACTGTCGGCTCGCTGGTGTTCTACTACCTGTTTACAGCGTTCTTCTGCGCTGTATTCGGCTGGACCAATACCGACTTTTACGACACGGAGGT
GGGCTATGGTGTGGTAGGCCAGCTTGTGCGCGAAGCGTGGTTCTGGCTTGGCCTCATGCTGTCTGTGATCATTGCCGTTTTGCCCAACTACATCGCCAAA
GCTGGACGAGTATTATTCTACCCAGAGCCGTCGCACCTGATGCGCGAGTGGAATCGTCTGGCCAAGggcgaagacgccgcagTGGCGATGGACTCACCGC
GGCTTGTACGCCGCAACACGGGCTTTGCATTCTCGCACTGCCCTGGCGAGACGGAAATGGCAATGGGCTTTTACCAAAACAGCAACACGCGAGGGCAGAC
TCGTGCAGGGCAGATGTCTGATCTCTCGGACGTTGGTTTGCGTGTGCaatcgccatcgtcgtcaactGCAGACGGGTCCTCGCCGTCCCCCAAGACATTG
AACTAG