Transcript Name :
Phypl_g13
Orientation:
(+)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_466642
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Small GTPase superfamily, ARF/SAR type1.5PR00328
Small GTPase superfamily, ARF/SAR type1.5PR00328
Small GTPase superfamily, ARF/SAR type1.5PR00328
Small GTPase superfamily, ARF/SAR type1.5PR00328
Profile scan predictionP-Valprediction_id
Small GTPase superfamily, ARF type13.273PS51417
HmmSmart predictionP-Valprediction_id
Small GTPase superfamily, SAR1-type9SM00178
Small GTPase superfamily, ARF type5.2SM00177
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-509
NN-scoreoddsWeighted Score
0.5251.1450.002
*** None ***
TypeScore
mitochondrial609
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
intracellularGO:0005622IEA
intracellular protein transportGO:0006886IEA
small GTPase mediated signal transductionGO:0007264IEA
*** None ***
*** None ***
Sequence
        1810 bases(100 bases per row)
ATGAGCGCCCGCAGGCTGCGTGAAGCGACCAAGACAACACCTCGGAGCGTGCCCGGTGCGTCGCTTGTGGCGGTCGATGCTAGTTGTGCCGGTCTTACCA
AGTGTGTGTTTTCGCCCTGCAGTCACCACACCATGCAAGGCTGTTGAGAATGAGCACGAGTACCTTCGGCAATGCGTGGACCCCGTCCTGATGCCGCTCA
TCGAGTCGCTACTGCTCTACCAGCCAGAGAGCGTCTACCACTTCATCCAcgacttcgtggacgagcagaaggTCAACCGCTTTGCGCACCGCCCGAGGAG
CGTAGGGTACGCCAAGACGCTTACCAACCGCCGCAATATGGCGGACTTCATGTCCACCAGTGTGATCCCCGTCATGGATGACCTGGCCAAACAGATTTTA
CGCGAGAAGCCAAACTCCGTCAAAGGTGAGCTTCGAACGGGATCTTCTAGTTGTCCGTCCACTCACTTTTGATTCTGATCCGTGTGTCCTTTTGATGGCA
AAGCTTTTATCCGAGATGTGGTCGCTGCACGTATCGTTATCGAATCCAGCAAACGCCCAGAGGAGGCGTCAAACCAGCTCGAAGCCGATGTTCATTTCAG
TATGAACGACCGCGTCTTGTGTCGGTACAAAGGTCGACCCAGGTTCTTTCCCGGCGTCATCACTGCTGTGGACGACAATGGTAGCTTCACCGTCTTGTAC
GATGACGGGAAGACAGAGAGCAGCGTCCACTACATGTGTCTGAAGCTGCACCCCACACAAGAAACCAACGAtaaagcagcagcacagaaAACGCATCATG
GAGAACCAGAAGACAACCAGGAAAAGTCGAAGGTCACTCGCACAATGGAGATCGTACTTCTGATCATTGGTATCGACGGGGCTGGAAAGACTACGCTGCT
ATCGACCTTACAGGGcgacctggagaaggagcacgTGCCAAGTGCAGGCTTCACATCTGCCACGTTCCAGACCGAGACGGGATCCGCTACTTTCTACGAC
CTTGGGGGTGGCCCAGCGTTTCGCAACGTGTGGAAGGAGTACTACGCAGACGTGAGTGCTCCTAGTTCGTGTTCTACGCTTAACTGTATTGACATTGACA
GCCGGGCCGTTTGGATTGCACAGGCCCATGGTGTTATCTTCGTGGTCGACTCCTCGAGCGAGAATTCGGTACTTCAGGCTGCAAACGTGCTCGAAGAATC
GATGGCAAACGATATCATGGTCAACAAGCCGTTGCTAATGTGCGTACAAACTTTGGTTCGACAGCTGAAATGACATACTGATCAAGTGCTGTGAACGTGC
AGCTTTGCCAACAAACGAGACCACTCTGACGCCGTTGCAGAACATGAGATGCCGAACTTGCTACGCTTGAACACGTTTCCTAGCTCCAAGATCGTCCCCT
GTGTCGCCAAGCCAGCAGTTTACAGCGGTGTGGTAGACGAACGTCTGGAAGAAGGTCTTCAGTGGCTCTTTGATCAGGTTCACAGCGACTTTGACACGCT
CCAAGATCGTGTCCAGCGTGATCTTGcactgaagaagaagcttgaccagcagcgacgggaGGAACAACGTGCTCGGGTCTCACGTTGGAAAGAAGAACGC
GAGCTCAACCAAATGCGCGCGCAGGACAAGCCATCAGTCGAGGAGGAAATCTCCTCCTCGAAAACTACTGCAGATAGTCCGGAAGAATCCGTCATATACT
GCTCGAATTGCACCACGGCACCAGCAATAACGAAGTGTGCAGCGTCCAAGTGGATGCCTGTCTGCGAAAACTGCGCAACAACTCTCAGAAGTCAATCGGC
ACAATCATAA