Transcript Name :
Phypl_g23
Orientation:
(-)
Number of Exons:
3
Description :
60S ribosomal protein L38
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-69
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K02923
*** None ***
Sequence
        393 bases(100 bases per row)
ATGGTACGCAGGCGTGCGGTCCTTGCCCGCTGCGCAGATGTGCGCGCTAGCAGGAGCGATACAGTCAGGCAGCTAACCGAAGACTTGTGCGTCTTGCCCA
CAGCCGAAGCAGATCACCGACATCCGCGATTTCCTGCAGAAGGCGCGCCGAAAAGATGCGCGCTCGgtgaagatcaagaagagcgacaaggTCGTCAAGT
TCAAGATCCGCTGCTCCAAGTACCTGTACACGCTCTGCGTGACGGACACGGAGAAGGCCGACAAGCTCACGCAGTCTCTGCCTCCTGGTATGACGACCCT
CGCAGCCCTCAGCCCTGCAGCTCTCGTGGCCCGTGACTGACTTTGTGACGGTGTTTTTGCTGCGAAACAGGACTCCAGCGCAAGGATATTTAG