Transcript Name :
Phypl_g28
Orientation:
(-)
Number of Exons:
9
Description :
hypothetical protein PHYSODRAFT_473388
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Kinesin, motor domain4.6PR00380
Kinesin, motor domain4.6PR00380
Kinesin, motor domain4.6PR00380
Kinesin, motor domain4.6PR00380
Profile scan predictionP-Valprediction_id
Kinesin, motor domain41.049PS50067
HmmSmart predictionP-Valprediction_id
Kinesin, motor domain1.4SM00129
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-648
NN-scoreoddsWeighted Score
0.5731.4830.003
*** None ***
TypeScore
nuclear565
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
microtubule bindingGO:0008017IEA
microtubule motor activityGO:0003777IEA
microtubule-based movementGO:0007018IEA
*** None ***
*** None ***
Sequence
        2533 bases(100 bases per row)
ATGGCGTGGAGAGCGACCAATGCGCGCGccgcaggcgctggcgctggccgcgggGCGcccgccgcggcgccgcgcgccaAGCCAACCATGCAGGCCATCG
CggagatcgagaagaagcgcgaggaccGGCGGcgcgccatggcggcggccaagcgcgagcgccagcgcgagagccagctgaacgagaagctcGGCCACCC
gggcgacgtggacttcCAGCGCATGATCAAGGCCTTCCGCGAGCAGAACAAGGACAAGAGTCGAGCGCACGCCGAGGCGGGGGACACCAAGATCATCATC
TGCGTGCGCAAGCGGCCGGTGAACGCCAAGGAGGTCAAGAAGCACGACTACGACGCCGTCACGTGCCTCAACCCCATGGCCATCGTGCACGACTGCAAGC
TGAAAGTGGACGGCATCACCAAGTACCTGGACAGCAACCCCTTCAACTTTGACCATGTACGGTGGGGGTTCTTGTGTCGCTTTTTGTGGGTTCACAAAGA
AGACAAGCTGATGGTATTTTGTTGATGGTGGTTTGTAGACTTTTGATGAGAACGCGACCAACGAGAGCGTGTACATGCACACTGCTCAGCCGCTGGTGAA
GTTTGTGTTCCGTGATGGAGGTCATGCAACAGTGTTTGCCTACGGACAGACGGGCAGTGGCAAGACGCACACGATGCAAGGCATCCAGAGCCAGATTGCG
GCGGATGTGTTTGCTCAGGCGGACGAGTTTGCGCGGCGTGGGTATCCGCTGGATATCTATGTGAGCTTCTTTGAAATCTACGGTGGGCGCTGCCAAGACC
TGCTGCATCGGCAGGTGCTGACCATTcgcgaagatggcgctggagaagtgcAGATTGTGGATctggaggaggtgcagcCGCAGGATACGGAAGAACTGCT
GCAAGTGATTAGCAAAGGCAACAGTCTCCGCACGACGCACGCTACAGAGGTGAACGATGtgtcgtcgcgctcgcacTGCATCTGTCAGATTAATCTCCGC
GAGAAAGGAACGGGGCAGCTACATGGCAAGTTGTCTTTGATCGACCTTGCGGGTAGTGAACGCGGTGAAGACACAAAGAATCATAATCGGCAGCGGCGAA
TGGAGTCTGCGGAAATCAACCGAAGTTTGCTGGCCCTGAAAGAGTGCTTCCGGTGTGTACACAAGTGGTGCACGTTAATGCAACCGTGATGAATTGTTGT
TAATCATGTGCCTTCCAATGTTTTAGAGCGCTGGACAGCGGTGGTCGAGGCACCCACATTCCTTTTCGAGCAAGCAAGCTCACTCAAGTGCTGAAAGATT
CGTTTGTCAACGCTAAAGCGAGGTACGTGATCACCTCGACTATCACTGTCGGGTGGCTCATCTAACGACATGGATGTTGGTGCCACCGATAGAACCGTGA
TGATTGCAGCAGTTTCGCCCTGtgcctcgtcctcggacCATACACTCAATACCCTTCGATATGCTGATCGGGTCAAGGAGAAGCGAGTTTCAGCGGATGC
ATTTGACGAGGGGAATCCAGAGTCTGATCCTGTGGATGTCGAGGATGTTCAATTTGAAGAGGGTACGTTTGAGGCTCTGATTTTTGTGTGGTGGGTTTGA
TTAGTACTGAGTTGTGTGTGATACCTACTCTTTGACTAGACATTAACGCGGACGAGGCGTATCCACCACAAgacgatgccgaagaagaatatgacgacga
cgaagaggagtATCAATCCGGGGAGGAATCTGACGAGGATGACGCAATGCTTGAAGGCAATGGAGATAAGTATAGGAGCGAcaccgacggcagcagcaac
gatgTAGTGACGATTTCTTCGCAACACACACGCGGAGGTCCTGATTTGGGTGACGACTTGAGTATCCTCCGCATTAGTCGTCGACGTCATTCTGGTACGT
TAATAGCGTACGTATGGCCTATGGAACGAGCTGGATCTTACGAATGtggtgtgctgctgatgtCAGATAAAAGGAGTGCCGACCCCGTGCAGGAGAGTGG
GTACTCTGAAGAAGCGTGGCAAGGAGTGGTTAGGATCAGCTTGATGACAACTTCATCCGCCAAACACGTTGCTAACAAGGATGCTGTCCCCCCATGACAG
GTCCATACGCTGtacgaagagcaagaaaGCTTGCTCAACACGCACATGAGCGCAATCCAGGTTTGTCCTTTCACCCAGAGACTAACGATGTATCTTGTTT
CTAAAATGTGTGTCGTTCACTTCGATGCAATAGGAAAACGCAGAGCTTTTAACAGAGGAAGGCGCCATGCTAGCATCGATTCAAAACGACGATTCGGCGA
GCATCGAGCAGTACATGTCACGTCTGGAAGAGGTGGGTGGCATCGTAGGTACAATGGGCTGTAGCCCTCAAGAGTCTAACAGCGTGTGACTGCACCAGAT
CCTTGCCCAGAAAGCGCAGACGATCAGCACTCTCCGACGACAGCTTGCTGCCTTTCGCCAGCATTGCgaaggcgaggaggagaaagcAGCCGAGACGCCG
CCCAAGAAAGTGGCTGAGCGGGGTGGCCGCTAG