Transcript Name :
Phypl_g15
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_309438
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-711
NN-scoreoddsWeighted Score
0.5241.2360.002
*** None ***
TypeScore
mitochondrial478
GO
*** None ***
*** None ***
*** None ***
Sequence
        2136 bases(100 bases per row)
ATGAGCAACGCCTTCAAGCGCGGCGACCTGACGCTCTTCACGTGTCCGCGCATCCGGCGCCCCGCGTACTGGCAGTGCATCAAGCTCGTCGCTCCCCCCG
GCGCCTCCCTCCCTCCCGGCCAAGAGAAATGGAGTagtgacgacgccgtggaggCATATTGTCTGCGATGCAACGTCGCGTTCCCCTTCCAGAAAGGATC
CAGCGCTTCGGTGCGCAGGCACATGACAGGCAACCACCCCCGAGAGCTGGAGGCTTTCAATGCAGGAGTGGAGACCGAAGGGGAGGCTCCAGCTGATAGC
AGGAGCGgggcgaagcgctcgtcgtccgagtcgtcaATGGACGATGATGAACCAATGGAACCAAGCGAACccgacagcagcgtttgTCAAccgctgacca
agaagaagcgcaccAAGCGGGATGATGCACTCGCGGCCATTTACTCTGGAGACCCAATGATGATGGACCTGCTGATTCGCTGGATCTGTGGCAGCTTGCA
GCCGCTGTCGACTGTGGTCGAGTCGGGCTTCATTAATCTCGTCAGTTTCCTCTCAATGGGAAAAACTGCGTTGCCCGACCGAGAAACTGTTTGCCGCATA
GTGGAGcacaaggcggcggagcaACGCTTTGAGAACATGCAGCGTGTGCATCACGAGGTGGGGCACTTCTCGCTCTCTGCAGAGATCTGGCAATCGGAGT
ACGAGAGCTCTTACGGAAGAGAAAAGTACCTGGTGCTGTTGTGCCACCACGTGAACTCGGATTTCGAGCCGGCTGCGTTTTCCCTGGGCGTGGTAAACAC
AGGAGATGGTCGTGTGGACAAGCTGGTTAACGACATTATGCGGGAGTGGGGAGTCTCGGTGAAGAAGGTATCCCTATTTTTGAGCAACAACGACAATATG
GTTTGTCAACTCGCTGCGGACCTTAACGTTAAGCGGTTCCCCGATATGTGGGCAGTGGTCCAGACGTCCCTTATTTGTTGGACCCGAGCAAGCGCAACTA
GTAACGCTGAAACTACCCCGGCCAACATTGGTGGACGTGTAACTGGTGCTGAAGTGGAAGCCAGCAGCGATAGACCCAAACATGTTGCTCAATCGAATGT
TGCTCTGGTGATCGCGGACCTCAAGAAGCTAGCAGATTACTTCGATTACGACTGGGGGTTGAAGAAGACTCTAATGCGCGCTCAGATCACCGGTGGGGAC
GAAGAGAGCCTGAAGATTCGGAAGGCTGATTGCAATTCGTGGGAGGAAGTGTATGATTTCTTGACCGAGTTGATGGTCTGGAGACCCTCAATCAATCGCT
TCTTCGCCACTTCATCACATTCCGCTATTGCAGAGCCTACTGCCAAGATGTGGTTTGTAGCGGAAGCTCTTCTTTTGCTATTGCGCACGCTGTGTGAGGT
TCAGCAAATTACCACGAAAGACAAGGCTCGCACACTACCGTTCATGATTCATTGCCTGGCGATTACCAAGCAGCAACTGAACCAAGGAAATGTCCTGGCT
GGATTAATCAAACATTATCGATTGACGATAGAGTTCGATGCGACGGAGATCAGCCAGGATCTGCTAACGCTTCAAAGGAGCATTCTGGAAGGTATCAGCA
CAAACGTCGACTCGTTGCTGTCGGAATTGCAGTGGTGCTCGCTCCTGGACCCAAGGTacgccaagatggagcaTGTCAGTGAAGACAAGCGTGAGCTGTG
CAAGCTGGCATTGGCAGAGCGGGCTCTTGAGTTGCATCGGAAGGATGCCCCTGCGCCAGGTCTGATGCACAGACTCCTGCAAGAGGAGGATGTGCGACCG
ACCGATGGCGTTGAACTGGAGGAGACGCGGATCTGCATTGCGGAAGAGGTATCGACGTACGTGaccgagcaccagcaacgcaaGAAGCGCATAACGGACC
CCTTCTCATGGTGGCGCGACAACCGCAAGCGCTATCCGTTCCTGTCGCCTTTGGCGCGGGTCTGGCTCGGGACCGTGGGCTGTTCGTCTGCTAGTATTGG
TGGGCTACGCCGTCGAATTCCATTCGAAGTGACCTTGGACAACCACCAGAACGAAAAGAGCGAAGACCTGTGGGAGACCATGATCAACATTCTCTACCTG
CACGCGTGCATCCGCAAACCGAAGGCGGATGAGTGA