Transcript Name :
Phypl_g27
Orientation:
(-)
Number of Exons:
8
Description :
hypothetical protein PHYSODRAFT_474252
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain2.5SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-586
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        2299 bases(100 bases per row)
ATGATGCAGCGCGGACTGGCGACCAAGCTCCTCTCGCGCGCCGTATCAGTCGCCAAGAGGAAGGCCACGCGCCTTTCAGTGGCCCTCGAAGTCTCTCTGT
GTGGCACCACAGCACAGATGCAGTCCAGCCAGGCTCTGCGCTCCTTGACAGTCGTCGCGGATTCCAGCAACTCGGCCCCCAATAGATTCGCAGCTATTGC
TGGGGCTGCAGCATTCGTTGGAGTCGTGGGACTCTCTGTGGATGCGGCGCAATTGGAGGCGGCTCCGGGCAAGAAACAGGAGAAGGTTGTTCGCTTATCG
CTGAGGCTTTAGGGAAGTTGTGACACATGACCTAAATGCTCAATGCGTTGCCATGTTTGCATGTTTGCAGCACTTTGAGTACGCTGAAGCGGTGGATACC
ATCCGCCAGCAAGTGTCGGAGTTCCGAACAACGTTAAAGAGCTCCGAGACCCGCATCCCCAAGGCTTTTcccatcaagaagatcgggATTTCCAGGATCC
ACGCGCCGAATGGCGTGTCCACGATCCGGATCGAGTTTGCGTGTCCGTCGTTCGTTGACCAGGAGGCGATCCTGGGTCGGTTCTTGCTGCGGCTCCAGAA
GGCATCGACACCAGGTTCCCGTCAGGCTGTCGAGGTGATGCCGGCTCCGCTGGATAGCTCAACGAAGAAGTCTGTTGTGGAGTCCTACGAACAACCTGCT
GTGACGTACCTGTACGCGAATGGATCTGGCTCGTTCCAGTTCTTGCGCGACACGTCTTCGTTGCAAGCGACGTCGAAGTTTGTTTTCTACAAGGATGAGC
ACCTCACACAAGGCGAGATCGACGCGGTTGTCGGGGCCTACAAGGAAATTTACTCGTATGCGAACGTGAACGCGTTCTTCCGCCACGATCTTGAGCAACG
TCGTAAGAACGCTCTCGTTGGACGCGGTAGAAACCCGACCACCGCTACTGCGGCTGCACCTGACAGCAAGGTTTGTTGTTGATGCGCCTTTTGTGGGCAT
TTTTAATGTATCTCACGTGTTCATTATGGGTGCAGGAAGAGGCtatccagcagctccaagctctTGGAATTGATGTGTTTGAGCCAACCCAAAACGGAAA
CAACTTGACGTGGGATAGTCTGGTACGTGATAGAGGCTAGTCGTTATTCAGGTGGGCATCATGAGCTTACACCGCGTTATGGTTGGGTTGTCTCTGAATA
CGTAGGCTGGGTACGAGAACGTGAAACTGGAGATTGAAGACACTGTTGTGCTGGCACTTCAGAATCCAGAGCTGTACGAGCGTATTGCGCAGAAAACCCG
CTGCCGCTTCGAGAGCAATCGCCCCCGTGCCGTGCTGTTTGAAGGCCCTCCAGGTACCGGCAAGACTTTGAGTGCGCGAATTATCGCGCAACAGGCTGGG
ATTCCTATGATCCATATTCCGATCGAGAGTGTGGTGTCCAAGTGGTATGGCGACAGTGAGAAGAAAATGTCGGCGATCTTTGACGCGTGTGAGAAGCTAG
ATGGTGCCATTATTTTCATTGATGAGGTACGGAATCACTAGAAATGGTATGGTAGCTTGTTGGTTCGAGGTTGACGCTGTATGCCTCTGTACGTGGTAGA
TTGACGCACTTGCCGGAGATCGTTCCGGTGGTACAATGCACGAGGCTTCGCGACGTATTTTGTCAGTTCTACTTCAAAAGGTGGAGGGATTTGCTTCTGC
CAAGAAGACCACCGTCGTGTGTGCCACCAACCGGTACGTTCTTTGTCTTTGCAAACTTGGGCTAGACAGCACCGTTCATTACTCATCTGCGAGTGTATTG
ATAATGTGTGCAGGAAACAAGATCTGGATGCCGCGTTAATCAGCCGTTTTGATCTTTCCATTCGCTACAATCTCCCTGACGAGAAGACCCGCCGTGCAGT
GTTTGCCCGGTATGTGTTGTGTGAAGAAGATACGTGGGGAGAAACGTGAGTACTAATAGTGGCTGCTTCTCCTAGCTATGCTAAACAGCTCTCCGGAGAA
GAACTCTCGCAATTGGCGGCCGTGTCACCGCAGCTCTCGTGCCGAGATATCAAAGAGGTAGGTTGGCGAATACGAGTTGCTAACTTCAGACGCGTGGAAT
GGTAGTCTTATGTGTATTTGTATATTTCTGGATGCCCAAATAGATATGTGAATATGCAGAGCGCAAGTGGGCCTCGAAGGTGTTGAAGAAGGAAGAGACG
ACCGAACTGCCTACTTTGCGAATCTACGTGGAGGCTGTGAAGACCCACGTGGGTGGTCTATCCAGTCACAGTTCTCAGCCTGATGTGTACGAGGCATAA