Transcript Name :
Phypl_g40
Orientation:
(+)
Number of Exons:
3
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Bromodomain2PR00503
Bromodomain2PR00503
Bromodomain2PR00503
Bromodomain2PR00503
Profile scan predictionP-Valprediction_id
Bromodomain17.439PS50014
NET domain16.971PS51525
HmmSmart predictionP-Valprediction_id
Bromodomain7.4SM00297
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
NET domainIPR027353
*** None ***
InsideOutsideTMhelix
1-218
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        814 bases(100 bases per row)
ATGGACCCCGAGAACAAGAAAAAATGTaccgacgtcgtggagcatTTCTTGAAGCTCGACAGCTGCGGTGAGTCGAGATTTCTATTGCTTTATGGCCCTA
AGGTACTGTGGAGATGGTACCTGTAAGCTGACGCGtatgctgctgcgtctgcagagCCGTTCCGCGAGCGTGTCAACTGGGAGGAATGGGGCCTGTACGA
CTATCTGCAGGTGGTGAAGGAGCCCATGGACCTGGGCACCATCCGCACCAAACTGAGCAAGAATGAGTACAAGAAGCCGGCGGAGTTTGCGCGCGACATG
CGCCTGGTCTGGAGCAACTGCAAGCTTTACAACCAGGACGGCTCGGACCTGTatctgctggccgacgagcTCACCAAGAAGTTCGAGGACCGCGTCAAGA
CCATGAAGCTTGACGTGGGCCCAGTGCCCAAGGCAGACAAGAGCATCCCGTACGATGCACTGCTGGTTAGATGAGGTACCGAGTTGGCGGAGGTTCTAat
ctgctgtgctgctggacagaCCCCCGAGTctcgaggagaagatccACTTCAGCCAGAACATCTACAAGGTCGAATCCAAGGACCTGGGCGCtatcgtgca
gctgctgcaggagcagtGCCCCAAGGCGCTCGACAAGAGCTCgccggacgagctggataTTGTTGTTGACCACATCGACAACAAGACTTTCCGCGACCTG
GAGaagttcgtgctggagaaggtgccgGAGGGCAGCCGCGAGCCAATCACGACGCCCAAGTCCTCCAAGAAATCTCGACGGCCAcccagcaagaagacca
aAACCGATGCGTGA