/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_b2558bb0ceb9eee52c18a32f2a6fb8b5 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1330343 -w 120 -web -o /tmp/images/bd_log_output_file_b2558bb0ceb9eee52c18a32f2a6fb8b5
Transcript Name :
Phypl_g24
Orientation:
(+)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, RING-type12.976PS50089
HmmSmart predictionP-Valprediction_id
Zinc finger, RING-type3.8SM00184
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-433
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        1302 bases(100 bases per row)
atggcgccgtcctcgtcgagccAGGAGTGCCACATCTgcctggaggagctgcgcagcgagctggtggccgcgCCGTGCGGCCACGTCTTCCACCACGTCT
GCATCATCCAGGCGTTGCAGGTCAATACGCAGTGCCCCAtctgtcgccgccgcacgGGGGACGCCGACCTCATCACGCTCTACTTCGACGTGCCGGGCGC
TGGCGAGGCCACGCGCGCTGATCTGCACCCGCTCAGGCCCGCGCAGGCCTCGGGAGACAGCGTGGCTCTCAGCTCGCGCGTCAACACGCTCATGGAGCGC
ATCCAGTGGCagaacaagcagcaggagcggctcgtggacgagctgcggcgtctgcgctgTCAGAGCGAGCAGCTACTGGCCGacaagcagacgctggccC
AGCGCGTGGGGGGCTTGGAAGCTGCAAAGAGCGAGCTGTTGACCAAAGTGGCGAGGTACCAGTTGGAGCTCACGCGCCaagcggaagctgcacgcAGATC
GAGCGTGAACCGGAGCATTGTCAATTACCTGGACACGTGCGACGCGTCGGcaatggaggaggagatACAGAACCCGAGAGAGCTCAtcatggcgctcaag
aaggcgtgCAAGTTCCGCCACGATCAGTACCAGAAAgtcgtgaaggagaagacgcgtCTCAAGGAGATGCTGAGGAATACGCAGCCTCTGGCTGGGCAAC
AGCATAGTGGAGGCCATGCTAGAGTCGGGAAGAGCAAGGCTCGGAGTGCAGGAGCCGTGGCGTTTGAGAGCAAACGCGCGTATCCGACGTTTGGACCGCG
ACTTGAGCCCCCAGTGGCAgagaacaagaagcgcaaggtcGACTCCTCGTCGGTGGGGTCAAACTCGATGCCtttcttcgagcagcagggCAACGATGGC
GGTTTAGGATTCACCCCACGAACCGAGTCGGCGGGATTCCGCGCGAACGCCTACTCGGACGTGTTGATccgcccgccgccgagttcacGGCAGACGTTCG
GCCGCAGCAACTTCAATCCGAACCAGTACGGAGCATTCAACTTGACGCCGTCGGACCAGCCTCCCGTACAGATGGCGGGACCTCAGGCCGCAGTGTGCCG
CCGTGGTTACGACGAAACCGGTAAGCTGACCAATTTTTTTCTCCCAAAGGAGGGCGAGTCGCGGTCCTTGTCTCGGAAAAAACCAATCCCGAGCATGCAG
AACCTGCTGAACTTACAACCAACAACTTCgggtcagcagcaacgcatTGCGAACAACGACCGTCAGGAGTACGCTCTAACAAACTGGCTGCGCAATAATT
AA