Transcript Name :
Phypl_g12
Orientation:
(-)
Number of Exons:
10
Description :
protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Leucine-rich repeat7.073PS51450
Leucine-rich repeat5.209PS51450
Protein kinase domain13.446PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain0.004SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-429
453-1041
430-452
NN-scoreoddsWeighted Score
0.7853.4430.007
*** None ***
TypeScore
nuclear348
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein bindingGO:0005515IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        5157 bases(100 bases per row)
ATGCGGCTGCAGATCCAGGCCGAACACTGGCTTTACACCCTGTTTATGCACGCTAGTCGCCCCACCACACCGCGGTGGGACACTTGTGCCATGGACCGAC
ACAAGGCACTGCCGCTCCATTACCCGCTCGACGTCCGAGCGGCTTCCGAGTGCCTGCGCCACAAAGCCTTCGCACCGTGGAACAAGTTCCATCCGCGCGG
TGCTGCTACTCTCGCCGCGAAAAAACCACCGGCGTCGCGTCGGTAGGAGGCCAGTTGCAGTCTCCTCACAACTAGCAAAACGTCTGACTGAACACCCCTC
TCTGTGCGTTGCTAACCAGGTTATAAGGTTCTAAGGGCACAAGAGACAGCGTGGCTTGGGTGCAAGAGGTCCCAGAGTTTTTCTACCGaacccagcagca
ggaacgcgCGGAAACGGGCAACATGCGCAGCGTCCGGAGGCTTGCGACGCTTGTggcggcagcgctggcggtCACCGGtgtcgtcgcagcagcggacgAC
GTGTGCACCCCACCGGAGCGCAACACGCTTAGCAGCAACTGCTACGgggcgtgcagctcgtcgttctGCGTGAACTACGCGTCGTCGACTGCCGAGGCCA
GGAGcaaggacgacagcgacggcggcttCTTCTATCGGGGATGCTCGACGGCCAAAATGCCGACGTGCAAGACGAAGGTGGCGTTGGGAGACTGCGAGGT
GCAGTGTCTCGTGGACACGCCGGCTAGCTGGAGCATGCCGCAGTGGACGCTGACGATCGCCCAACCCCAGAGCGACAAGGCCGACACCGCCGTCTTCCAG
GAGATTGACGACCTtacgctgccgtcgacgctgcaaAACCTGTACGTTGGACGTTagtggagatgctgctggaatgCGTGACAGCCCATCTGACGTTGGT
GGTTGTGTGTATGCTTGTGATTTGCAGTACGATCGTCGGCGCGACGGCAAACTCACAGATCACTGTCCCGCTCTCTTTTACGTCGGCCGCCTTTCGCAGC
GgcacagcgctgcagcaactgtACGTGCATTTTTGATGCCTCGTTTGATGTGGGTTTCAGAAGTACTTacgctgttgttgttgttgctctCTTTCTACTT
CCAGTGTAATTTCAGACGTTAATGTCGGTGATATGCTCACAAACGTCTTTCCGGACTCGCTTCAGACGCTGTAAGTTCTCGCTTGCTCTCACTATTTCTC
GGTTGAAGAAAATGTAACTGATatgtttttttcttctcaTTATGCAGTATCATTCAGCGATCAAAGCTCACTCAGTTTGATCCTCGTGGCTCGCACGCGT
TCACGTCAGTGTCCACTTTGTACGTACAATATCTCTTATTTATTTGTTTTTTCGAGAATTTTGTTAACATCAGTATTCTACTTTACAGAGACCTCCGTGA
CAACCAACTGTCAGATATCCCAACCATTATTTATGAAATGCGCAACCTGTCGGCTCTGTATCTGCAAGGCAACGCCATTGCTGACGCTCATGTCACCCTG
CCCCAACTCCAGTATTTGCAGGAACTTCCTGTTTTCAAAGCGAATTTGACAGTGAACggaagctgctccaccgGCTACGAAGCGGTATCGTGGGGTGACA
AGTGTGTTTGTTACACAAACGGTGACGGTCTTGGCAGCATCAACAGTTCTGGTtccaaggagaagagcacgacCTCTACAGCTAGCGAGAGTAACAGCAG
TTCTGTGGTGCTCTTTGTTGTTCTGGGGCTGACGCTCTTCACTGTTCTCGCTGTGGTTGGCGGTGTTCTGGTTCTGCGACGATGGAAACAAACGGCAGCA
AAGGAGCAGCATGATTCGCTTGTGTCTGCCGATGGAAAAATCAAGGCCAACCTGAAAATCCTAAGAGCAAGACTGGGTGTAAACGGTACGGTCCAGACGA
CGGAGCTCGAGACTTCATTGAACGAGTACAGCACCCGAGGGGGGCTGCGCAAGGCGGCATTCAAGGAGATCCCAGCCACTGACGTGGTAATGCTGAACCA
GTTGTCAGCTTCAGGCCCTGTGGTGGTCGCACTTGCTAAGCATCGTACCAAGTTGGTACTCGTGACAAAGCTTCAGACCAGTGATGACGATGTGGAGGCA
GCTTTGGATATGGTCCCGACACTTTCACAGATGCATCACCCACAACTACTCTCGATTAGTGGACTTGTTTGGGACGAACGGCACGCGATGACTGCTGTGT
GTGAATACATGCCGCTGGGCACACTAGAAGCTTACCTCCGGAGTTCTGGATCGGAGCTCAACTGGAAGAACTTCAAGatgaaagcagcagcagagatCGC
GCGTGGGCTGATGTACCTGCACAGCCAGCACATGGTGACTTATGACGGGCTGAATGGTAGAAGTGTGTTCGTCGACCCTAGCAAGGGCTGCAAGCTGAAC
CCGATTCAGGCAGCTCTCCCTACGGATAGATCGTCGCCCTACAGTTGCCAGTCGTACTACCGCCATTGCGATTCCACCAACAAGGCATTTTTCGCCCCGG
AAATCTTGATCGGTGAACCGTCTCGATCGTCATCAGATATGTACGCGTTCGGTGTGCTGCTTGCCCACCTGGACACGTGCCAGACGGCGGATGAAATGAT
CagaagttcgtggagaaTGCGGACACACATCGGCGATTTTGACACTGAAAACGGCACTCTTCTCTCAACCGACGGCACGGTTGTATCAACAAATTCGTCT
GACTCTGACAACTCGCGGCGACGCACCACCCAGCTCGAAAGCCTGCCGAGTGCCAACAGCTCGCGTACGCTGCAGAGCTCTCGAAGTCTTGCCGTGGAGG
AAACGCGACGACGAACCACTCCCGTGCTGGGTGCCcacaacaacgacgacacCAGCTTCATGGGTATGTTCACTTTCACACCCGACTGCCCCACGATGGT
CCGGGAGCTGGCAGGTGCGTGTCTTCAGTACGACCCATCGCTACGCCCCAGCGCGTCCTACATCGCCGCAATGCTGCACATCTAGGCAAACCTACAAGCA
GAGATACTATACataaaacaaaacaaaaagTACAATAGCACCCTGAAACGTTTGAAATATATCTTCTGTGATGCACATCAGTACAGTGAAGTGTCGATCA
CTCTTTGAGGTTGATAGATTGGAGCGGGACGCGACGCAGACAGCCTGAGAGAGGTGTTTTCTCCTCTCTTCTTCTTACCGTCTACTCCCATCAAAGTGAT
GGCACCATTTACAAAAAAATCGAAATGTTTGGCCTCACTTTGAAAGCACCCCCCCCCTCACCGAACGATGGCGCTGTATCATGCCACGCCTTCTGCTTCG
TTTGGGCGTTCAAGTTCTTGCTCAGCTTCGCGCTCGCCGAGTGGTGAAGCGACTAATGAGTGCGTGATTTGCCTCGAAAGTCTGGAGAAGAGCTTGGCAA
CTTTGCCGTGCGGTCACGTTTTCCACCACGTCTGCGTGATGGAAGCGCTTGCACGCCGCCATGCTTGTCCAGTGTGCAGGCGCAAAGCGAGCCCCAGAAA
CGCAGTTCAACTGTACCTGTGTATTGCGACAGGCTATGACAGCGCGGGCAGCGAAGCTGCATTCGGCACTAGCCGCAGCGAAGCAACCGCCACAACAGCG
TCGCGGCTTCCTGAACGCCTGAGAGAGATGAAGAGTGAGCTTGACCGTGTgcaccaggtccagcagATGATTTCCAGCTACTCGTTTCGGCTGGAGAATG
AATTAGTGCGTCgacagcagaagctcgagcagacCACTCGACGCCTGCAGCATATCCAGAGCGAATTGGACAGTGCGAATGCCCAGTTGAAGAGATGGCA
GCGGATTGGTACGAGTCTGCCTCTCTTTCGATGCTGTGCACACATCGTCAGTACACTGTAGTACCGTACTAACATTTCGCTGTTTGTGCCTCTGAAATGT
GAGCAGCCACCACGAGTTACGCACAGGCGAACCAGGCCAAGCAGAGAAAagatgagctggagcggaaGGCTCGCACCACCGCCGACCGACTGCTGGGGAA
GATCCGGGAGCGCCAGCACTCCCGCTGTCCGAGCTGCGCGAACGAGAGGgccgagatgcagcgcgttgcGCGGGAGTTCGTCACTGCAGTCGGAGCTGGC
CCCCGCACTTCTTGCTGTCCGCGCCACGGTCACCATACTGCACCGAGGGACATGGCCAGAGCGGCTCCGACGTCGTGGGCGCAGGGGCTGCGgcaaacag
cagcttcgctgCACGATCAGCGTGAGTACAGCTTTTGAAGATCGGTGCACATGATCTGCTGGTAGGTCTGTTTGGAGAGAGACCTACAGTAGTTTTCCAC
GAGTGGCGGCGTGCTGTGTCTGCACAAGTGGACAGCCATGCGTGCTAATACATGTAACTTTGTCTGACAAAGCCTGACAAATTGACAGGCTTGCACGATG
CGTAAAAGCAAAAATGGATACAAAACTGTACGCATGAGGAATTTACTTGCGGTAATTCAGTGAAAATCACTGAGATTTGTCTAATGGATATGACACCAGG
GAAGCACTGACCTCAGTACTCCATCGATACTACTACTATTTCCAGATCGTGCAAAGTACTATCATCTGAACATCAGCGGCAGCCAAGGACCAGCACGATG
TTTCCACTGACCGTATTGGCCTGAATCGAAGAATCCCACGCATAATACCTAACTTTCAATGTACATTACCACGATTTGAATAGCGTTGTGCACGCTGTTC
AACCTACGAAGCCGGAGGAGCTCGTTGAAATCGGAGCTCGGGGGTTGCAGATAACCGTGACTGTAGAATGTATACGTGTTACCTCTCTGTCTAGGTGGTG
ACGAGCCTGTTGATCACACCACAAATTTTGTATTGCATACTACAGCCGGTAGTACATCTGTATTTGATGAGTTAAATACGCTGTATGCGTACCTGTAAGA
GTGCAAGTGGAAGTGTTGCAATTACGACGAAGCATGGCTGGCGGCCTGTCAGTGACGAGTGAATCGTGTTTATCCCGCGAGCGCCGATGACGAAATCTAA
AGGGTGTTACATCGGCCGGAATAACCCAAGCTCCCTGCCCTCCTCTAATAGCCCCGGCGTCATCGCCGTGGTGTCGTCCTTCCTGTCCATCTTCGGCGTG
AACCTGCAGAAGTACAGCCacgacaaggaggagctgcgcgccgtgcaGCGCCCGTAA