/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_4181b67116f595e354f8e999047ddc34 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1330343 -w 120 -web -o /tmp/images/bd_log_output_file_4181b67116f595e354f8e999047ddc34
Transcript Name :
Phypl_g37
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_469149
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-86
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        474 bases(100 bases per row)
atgaccaccaccacgcacCCGTTCGAATGGTACGCCGCCTCGCAACCCGTGCTGTGGATGAGCCTGGCGCTTTACTAACTTTGCCTGCATGGCCGGCTCT
CTGCAGCGACATTAGCCTGAGCTTCcccgaggaggtggacgcgcagctcgtgctgcagacgctcgaagtcgacgaggagctgcagcccgagAAGATCCAC
CGCACGCTGACCGTCAAGGGCACGGAGCTCCACGTGTAAGTTTGCCTTCGTCAGCCTTTTGCTGTAGTTGTAGTTGTAGTTGTGGTTGCTTTGCTTTCTA
TGCTGTGGGCTGCAGGTGCTAACGCTCCCAATGTGGTGTCCTCCTGGattggtggcggtggtgcgtTGCAGCCACTTCGAGACCACGGAGATCCGactgc
tgcgcgccgcggTGTCTTCCTTCTACGACATGAGCGCGCTGACCGCCAGGACGCTGTTGGAGTTCAAGGAGTGA