Transcript Name :
Phypl_g9
Orientation:
(-)
Number of Exons:
2
Description :
Poly(A) polymerase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-235
259-693
236-258
NN-scoreoddsWeighted Score
0.7693.4990.007
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
KO ID
K14376
*** None ***
Sequence
        2164 bases(100 bases per row)
ATGCAGAGCGCGACGTTCACCGTGGCgccgcacgtgctggagcaggcgtACAAGGCCATccggacgacgccgccggaGCCCAAGGACCAGGAGCAGTCGG
CCAAGCTACATAGCTTCATGGACGAGCACTTCCCCACCGAGTCGGACGCCAACATcacgcgccgctcgctgatcctggccgagctgcgctCCATCTTCCG
CGCCTGGGTCAAGCAGGTGTGCATGGACAAGGGCGTGCCCGAGGAGATGGCGGCCGACGCGGGCGGCCAGATCTTGGTCTCGGGCTCGTACCGACTCGGC
GTCAACGAGCCGGGAGCGGATATTGACACCATCTGCGTGGCGCCGCGCCACGTGACGCGCGAAGACTTTTTCTCGTCGCTTCAGGACATTTTCCTGAAAC
ATCCCAAGGTGTCACACCTCGTGGCCATCGAAGGCGCCATTGTGCCGCTCATCACCTTTGACTACGAGGAGATCAACATCGACCTGCAGATTGCCATTCT
GCCGCGGAATTCCATCCCGGAGAACCTCAACATCCTGGACGACCACGTGCTGGTTGGCGTGGACCCGGCCACCGAGAAGAGTCTCAACGGCCCCAGAGTG
ACCGAGCTCATGATCAAGCTCACGCCGAACCGCGAGAGCTTCATCGGCGTGCTACGTATTGTAAGAAGATGGGCTAAGAGACGCGGACTGTACTCGAACA
AGATGGGATACCTCGGCGGTGTCAATTGGTGCATCTTGGTGTGCTTTATCAACCAGCTGTAcccgacggcggcgccgtcgaccTTGTTGCTGCGTTTTTT
CATGGTGCTGAACAACTGGAAGTGGCCGCTTGCCATCCAGCTCTGCAAGACCCACGATGCCAACCTCGGCCTGGACGTTTGGAACGCCAACGCGGGTCAC
AATCGGTGAGTTTACGATCGTTtccatttttttttacttaTTTGTCTTGCATTACTGACGTGTGATCCATGCTTTTGTTTAATTTAGATACCAAGTGATG
CCGATCCTGACGCCGGCGTACCCGTCGATGAACTCTTCGTTTAACGTGTCGACGCACAGCCTGTCGGTTATGAAGGAGGAGTTCAAGCGTGGCTTGACCA
TCGTGCAAGACGTGCTCAGCAAGGGTGGCTCGGAGTGGGGACCGCTGTTTGAGCCTTCAGAGTTTTTCGCCGTCCACCAACACTACCTCGCGGTCGAGGT
GTACACGGAGAAGCAGGATGAGGAACCGGCGTGGTGCAGTTTTTGCGAATCTCGTATGCGTAAATTGGTGGAGTCCTTGGCGTACAACCCGGCGCTCTGC
CGCTTGCGTGTGTTCACGAAGAAGTTTCCGCTGAGCTACGTGACAGGTGACGAGGCTCCGGCGGGCGAGCAATCTAACGGCCAGCCTCCCGCCCAGCCCA
GCAAGTTTGGCGCCTGCTTTTATGTGGGCTTCGATATTGATCGCCGTCAATTGCGCAGTCGTGAAGTGAGCATCGACCATTCAGTGGAGTATTTCAAGAA
CAATGATCTGTACCGCTGGAACAAGCGAACGCCTACGATGGACGTGCGAGTTACTCCGATTATTTGGAAAGCGTTGCCGGAGAGTGTGTTTGAAGACATG
GGCGGGCGTGCAGTTGCGCGTGCCGCTCGTCGTGAgttcatgaagaagaagaaggacgaggaaaAGAAGGCTgaagaggctgcagctccgagccCTTCGC
CTTCGGGTGATGAAGGTACGCACTCGCAAGAGGATGGAGAAGATTTGACTTGCAGTCAAAAGGCAGCATCGCTGGCAACTGAGATGGAAAACGGCAAGGG
CAGTATTTCGCAACCTGGAAGTCCAAATCCTGCAGCCGATGGGGGTGATGTGAACGGCACAGATTCAGTCAAAAACACTCCActcaaggagaagaaagTG
GTGTCGGTGTCATCTCCAGAAATGACAGGTAAGCGTGACCGAGATGGCAGTGCTGTGGGTGAAGGTGGTAGCCCGGACGGGAAACCGTTgggtgctgctc
acgactCTGCGAATACGTCGGCAAATGATGCGGCAGCTCGGGGGATTGCTTCACCGCCcgtgaaggtggtgaagaagcCCTTGGAGTTGGCGGCGGCTCC
CccagctgcgtcgtcgccgcgcaAGAGACGTAAAATGAAAATCACTTTTGCCAAACTGAATTGA