/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_3fe0bbb6516a17ced4273c808b88887e -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1330343 -w 120 -web -o /tmp/images/bd_log_output_file_3fe0bbb6516a17ced4273c808b88887e
Transcript Name :
Phypl_g22
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein PHYSODRAFT_353568
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA recognition motif domain18.7PS50102
RNA recognition motif domain11.094PS50102
HmmSmart predictionP-Valprediction_id
RNA recognition motif domain1.5SM00360
RNA recognition motif domain3.6SM00360
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-212
NN-scoreoddsWeighted Score
0.7853.7370.007
*** None ***
TypeScore
cytoplasmic522
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
*** None ***
*** None ***
Sequence
        1522 bases(100 bases per row)
ATGGGCACTCGCGTGTACGTGGGCGGCCTCCCGCGCGACGCCACCTCGCGTGAGATCCAGGACGGCTTCAACCGCTACGGCCACGTGTCCAACATCTGGG
TGGCGCGCAACCCGCCCGGCTTCGCTTTCGTGGTGagttgagctgcttcttcccCCCTCGGCGCGGGGCCTCGCTCGCATGATGGCGCGCGTGTCCTCCC
TCTTCCTCCCCCTACTCCTCCTCTCCCTGCGGCATCGACGCGTGTCCAAGCAATCGGGGCGCGGCGGTCTGTCGGTGGCAGCGTGTGTGTCTTTTCGATG
TCTGTATACTATACATGGTGCATGTATACACGCTGCCCTACCACGACCGTCGCCACCGAGTCTCCAGTGTGGCGATTTGCGGTTTCGCTCTGAGCTCCCC
CGTCTCCGGCTCGacagcctcgtcgtctgctgctgctacttgTGTCGACTTCGGTGCTTCCTTCTACCGCTGGAGGGAGAGATAGAGAAGAGCCTCTCGA
TGGATGAACAACCCCACACGCACGTGCCATCATGCCGCGTCTCGCCTCGCTTCGTGccgcgccatcgccaccatcttcatcctcgccTGCCCCCGATCCG
AACCGTACCAACCAACGcctctccatcgtcgtcctcccCATTCCTGCCCCCCCACCTCTTCTCTAGGACTTCGAAGACCCGCGTGACGCTGACGATGCCA
TTCGCTCCATGGACGGCCGCGACTTCCTCGGTGGACGGTAAGAGGCTGCACAGGAGTAGCGCTGGGTGTGTTTGACCTGACATCTTGTGTGTGTGCTTTG
TTGGTGTTGTCCTGGACCAGCATTCGTGTTGAgctcgctcgtggtggtAGCCGCCGcgatggcggtggtggcggtggccgtcgtggagacgacgaccgcg
gtggacgtggtggtggtggcgaccgcTTCGACCGTGGTACGCTGAATTGCAGATATCATCTCTCCTGTTGGGGTTTTACCATTGCTTGTATAGTGGTGTG
GCCCTAGTCTAACTTTTGGATGGTGTGCTTGCTCTGCGTTTAGGTCGCAACCCGCCCCAGCGCACTGACTACCGTGTTCGCGTGACGGACCTTCCGCGTG
ACGTGGACTGGCGTAACGTTAAGGACTTTCTCCGCACGGGTGGCGAGGTCACCTACTGCAACATTGAGGCGGATGGCTCTGCGTAAGTACTTCGTTTCAC
CCGCTAGACTGAACCTTGTATCAGTTACTGACTTGGTGCATGGTTTTGACTTCCTGTGGTTCAGCATCGCTGAGTTTCAGACCAAGGATGACATGGAGGA
CGCtgtcaagaagctcgacgacaCGGAGTTCCGTGGTAGCTACGTGCGCGTTGCCCCCGAGGGAGACTCGAGTCGCCGTTCGCGCTCTCGCTCCCCTGCT
CGCGGCCGTTCGCCGAGCCGTCGCTCGCGTTCGCGCTCGCCTGCTGCGCGTAAGGACTCACCGCGCCGTTCGCGCTCCAGATCGGTCTCGCCTGCCGCTG
CCCGCTCGCCCAGCCCCCGTAA