Transcript Name :
Phypl_g29
Orientation:
(+)
Number of Exons:
8
Description :
aspartate aminotransferase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
DNA binding HTH domain, Psq-type17.017PS50960
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-552
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
DNA bindingGO:0003677IEA
*** None ***
*** None ***
Sequence
        2255 bases(100 bases per row)
ATGGCGCGGCAGGCCACCGAGTCGGCGGAGATCGaggcggccatcgccgccgtgcAGAGCGGCTCCATGTCGCTGCGGGAGGCCGCACGTAAGTTCGACG
TGCCCCGCACCACGTTGCAGCGCCGGGTGCAGCGGCGCGCGTCGGAAGCCTCCGAGACGGTAGAGGAGGGGGGTctcgagcaggaggagggcgCTGCTCC
TGTCGACGCCACCGCTCCGagcgacacgagcagcgaggACACTGCGGAGCCCGAGAGTCAAGAACCAGCAACTGTCACAGGGCGCAAGCGATCGGCGAgt
gagctggagacgcccAGCCAAGGTGGAcagagttttttttttttactgcATGTGACGAGGCTGCGAAGGCGTTTTGTGACGGCATTTTGGGTGGGAATTT
AGGACCGAGGAAGGTGATCAACTGCAAGATTAGGATGCTGTGCACGGCGGCCGGtagcgcgctggacgagctgagcaACGAGATGATCCGGGACGGGAAA
TGCATCTACAAGTTGGGATTGGGCCAGTCGCCGTTCCCGATCCCACAGTGCATTGTCGATGAACTGCGGTGAGTGGAGGGAGGACACTTGGTCTTATCGA
TAGCGGAAAAGTTGAGGCTGATTGGGGGGTTGTGGTGCAGTGCCAATTCGCACCAGAGAGACTATTTGCCGGTTGCGGGACTGCCGGAGCTTTGTGAAGA
TATTGCAGCGTGGGGAACGGACCGGTTGCATATCAACTACTCGCGAGATGATGTTTTGGTGGGCCCTGGCACCAAAGAACTGCTgtttgtgctgcagacg
GTATATTATGGAGACCTACTGCTGCCCAACccgagctgcacaagctaCGCGCCACAGGCCGCTATTGCTGGAAGGTGCGTGGCTGAATGACTGTGTTTGC
ACACTTGCTTGTTGTTGTGAGCGGGATTCTGATTATGATCTTTTGCTATATAAAAAGAAATATGATGTGGCTCCCAACACATGCCGAGGACCATTTCGTG
CTTCGCCCTGAAGTACTGGAAGAACATTGCGCGAAAGACCCAGGTACACATGGCGTTGACATTGATAGTGCCTCTCCGCGTGGCTGGTGTTTTGCTGACG
TTGCTGGGATTCTTTTATCAGATGCTCCTCGGATTCTCATTCTAAACAGCCCGTCAAATCCAACCGGCTGTGCTTACCAGGCCGATGAGGTTTGTGTCGT
TTACTTCGTGATTTCGTCTCGTGAAAAGTGGAGGCGGCGAACTAACGATGTTCCATGATCATTATTCACTAGCTGGAGGCACTTGCAAAGGTCGCGAGGA
AATACCGGATCCTCGTGGTTTCGGACGAAATCTACTCGGAGCTGCACCATTCTGGCACGCACCTGTCGCTTTCCAAGTACTACCCGGAAGGGACCATCGT
TTCAGGAGGATTGAGTAAGTGGtgcggtgctggtggctggCGAATGGGCTTCTGGTTATTCCCGCCCAGTATGGACtggttgcgcagcagcatgctCGTC
ATGGCATCCGAAACGTACACGTCCGTCGCTTCGCCAATCCAGCATGCCGCTCGACGAGCGTTCGTTCTCGAGTACGTAGCACGGTCCTGCCTTCTCCGCG
AAGAGGCAACCCCAAGGGATCGCAACAACGTCTCACCTACTTGTGATTGTTTACTCTCTGCTCTctgctctctctctttctGTAGTTGCGTCGAGCTCGC
GTCGTACAAGCGCAAGTGccagaagacgctgcagcttaTCGGTCGCTGGTTCGCCtaccagctgcagaagatggATGTTGAGGTCCAGGTCCCCGAGGCC
GGCTTCTATCTGTTCCCGTGCTTCCGACGCCACCGCAAGGCGCTCGCATTGAGAGGCATTtcgacggacgagcagctgtGCGCGCAGCTGTTGCAGGATA
CGGGCGTGGCCATCTTGCCGGGCTCGGCCTTCGGTCGTGCGCCAGAAGAGCTCTTCGCGCGGCTGGCCTTCGTAGCGTTCAAGGGAGACGTGTCATTGTA
CTGTGTGGAAAGCATGGTGAGCATTTCATGCAAGTGAGCCCATGCCACCGAAACGCTGACTTCCCTCTCACGCCTACGTTTCTGCCTCTTGCTTTTTCGC
AGCAAGACGACCCGTCTCTGGAGGCCATCGACGGCTTCATTCAGTCGGTCTGTCCGAATCTTGACATCGCCATGCGCAAGCTGGCGGCGTGGATGGCTCT
TGCTCGGCCGTCTGCCGCGCCAACAACGGCCAGCGCCTCAGGCGTCGCCTTGTAG