Transcript Name :
Phypl_g46
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site7.254PS50096
IQ motif, EF-hand binding site6.65PS50096
IQ motif, EF-hand binding site8.828PS50096
IQ motif, EF-hand binding site8.169PS50096
IQ motif, EF-hand binding site6.614PS50096
IQ motif, EF-hand binding site8.114PS50096
Sterile alpha motif domain16.949PS50105
Ankyrin repeat-containing domain21.561PS50297
Ankyrin repeat9.698PS50088
Ankyrin repeat10.846PS50088
HmmSmart predictionP-Valprediction_id
IQ motif, EF-hand binding site28SM00015
IQ motif, EF-hand binding site1.1SM00015
IQ motif, EF-hand binding site91SM00015
IQ motif, EF-hand binding site5.3SM00015
IQ motif, EF-hand binding site140SM00015
Sterile alpha motif domain1.2SM00454
Ankyrin repeat0.018SM00248
Ankyrin repeat110SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-2315
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        7021 bases(100 bases per row)
ATGAAGCAACAGCAGTATGGCCAGATTCAGATCCTGCGTGAAAGCGTACCAGTCGTGGACTTGGAGAGGGAGCCACGCACGAGTCGATCTTGGCGCTGGG
TCTGCTCGGCGCTCGTGAGCCGAGACAAAGGCGAATGTTGTGTGAACGTGGTGGAGAGCGTGTTCgtggacaagcagcagattTGGTCCTGGTACTTCAC
AGACGGCGGTGCCGTGCGCCGCAAGCCGCAGAGCAGACTCACAGCGGAGCAAGTGCATCGCGCGTTTGCACAGTTTGCAGACGAAGTTGGCGGTGTCGAC
GCTACGTCCGACCCCGCGACGCGCGCTATCGCTGTGTGTTGGTTCGAGAAGAATGACACACCGGGCGCCGTGCCATTCCTCACGACACCAGATCTCTTAG
CTTTCTTACAGTCTGTttcgtcaagcagctcgtgcagtgcCGCTATCAGCACTTTCGTTCGACCACGCGGAGAATTGGATCCAGTGTGCTACGCCAATCT
CGAGCATGAGTTCACGTACGTGGCGTGCGTTGTATTGTTGGAGTCCCCCATACTACTCGATGCTCACACGCGGTTTGTGTCTGTACAGGCTTCAGAAGAG
CGGCCGCGTGCAGGGTAAGCTGTTTTGGTTGGCGCTCGGCGGCCAACGGATTGCAAGCAAGGACGTCAAGTTGAACACCGTCGTCAACGAATTGGTTCAG
CACTTTATCGGCTTTatcgagaagaacaagaagtgCCGTGTAgtgcgctgcgtctcgctcTTCATACTGGAGGACAGCGGGAAGCTGCACTTGTGGCGGA
CGTCCACATGCGAGACCATCTCAGCTGCAGTGGCGctgtctgcagctccgacgtTCCCGGACGCACCAGTATCGACGTTCTCAAGCTCGTACGAGGGCCC
GCGCGCCATGAACGAAAGATTGATAGCTCGTGCCCGAGCCGAAGGCTCGCGGGCTCCTGATGAACGGGTAGTTGACGCTATCATGGCAGCTCCAACGCCG
CACTCCAGTAGAATTTCGGTTCGAGTACTACCAGCTGCATCTTCGAGTGCCTTGACTCGCTTGGATCCGCTCGGAGATCTGGAGGGGAGACGCCGTGCAA
acctcgagctgcgcagctccagtgACTGGGACGAAGCTTTGTCCTTTCTTCCGGCGACATCTTCGCTGTAtcgagggcggcggcgcaccatggcagcagc
tcacctAATGTCGAGTCAGAAGCGAGGTTGCTGCGGAGATTTTTGTAGCATGGCCATTACCGAGTTGACTGTCCGGCGGATGGAGCGTAAGAAGGAATCG
ACACTACGCGAGCAGGCAGGCCACGCTAGAAAAGGTCGACGACGGACAAGTGTCGCCACGGCCACAGCTGCTGCCAGTTCCTTCATGGAAACTCGTCGCG
CGGACGACTTTTTGGGCCGCCTAGCCGAGAAGCGAAAGCCATCGTCTCCACAAAGACTCCAACGTGTCGAGTCACTTCAGCCGCAGCCACCGACACATAC
CATTCCGTTCAAGCTGGTCGCACAGACTCGAGCCGAAAAACAGCTTGTGGATCTGTTTCTTCGGCGATACCAAAGTGGGGAAGACGGCGACTACCTCGCA
GAGGCCTACTACGGAGATGGCGAGCCCCTCGGAGTCACATTTCCAGGATATTACTACCGAGACGTGCAGGTGTGCGCCAACTGCTACGAGTTTTACATGT
TGGTGGAAAAAGTCCGCATGAAAGCTCTGAATCAAATTGCGCGACGTGCGAAAACGAGTCCAAGTCGCCGGAGACCGGAGGGGAACGACCCCGACATACA
CCAAAAGAGTCGACAGGAAGAGAATCAGGGtggcgacgacatcgacgacagTGACGACAAACTGTCGGAAAACTTGGACAACTTCCAGCATGTGTGGAAG
CACGTGTGGGCACAAACCTCCTCTGTGACCGCAGCAATAaccaagaaggacgcggcggaGTTGTACAGTTTTGTAAATCCACACCCTGCTGTTGCAATGG
TCATGAGTGGACTGGGAGCTTTGCTACTGGGATCACGAGGTGGAGACTGGGGAGAAGTTAAACGCGTTATCTCTCAAGATAAACTTCTAGCTCGGTTGCA
CCGTGTGGACCTGGAGGCACTCTCCGAACGTGCCGTCATGCAGGCTGCCGCACACGCTCGTAACCCACTCTTCACTCCCGCACAGATCGCCCCAATTAGT
TCATGTGCCGCGCGATTCTGCGATTGGATCCGAACTGTACTGCAGGCTTACGCGTGGAAGCAGAGACTGCAAATGCAAGACTCGGAGACACGACGCATGC
TTTGCTTGCTTAAACCAGAGATCCTGCCACCCGATGCCGCTGTTTCTCAACACGAAGAAGCCCACCGTGAAAAAGCGATagcgaagaagtcgaagacAAC
CGATGCAAGCAACGATGGCCCATTATCCAAGTCACAACGCCAGAGCCAGCAGAAACAAACGGCTCGACGCGCCGTTCAAGAGCAGCAAATGACACGTCTT
GCCGCACCATCAGGGCTTCTAGATGGTATGGTGGGAAGCACCGCGGACAACGTATTCATCTGCCAGGATGGAGTAACGCAGATTCCGTACGCTGTCATCG
GGCAGCCCATTGGAGAGACCGTCAAGTGCAACCTCGTCGTCTTTCACGACCTCTTCGACACACTCGAAAGCACGCGGGTATTCTTCCGGCCAATTGTCGC
GCGAAATGTGGGTGCCCGAGCGCTGCTGTTCAATTTCCCAGGCCAGGCTGGATCGGTGTATGCTGTCGATGACCAAGTCCGTGAAGAAGACAAACTCGTG
CTGAACAACATGTGGCTTGCTCGTCGAGTACACGAGCTTCTcaacttcctgcagcacacaACCCAGTTCGTGACCACTGGTGCTCCTTTCCATATCGTTG
GCTTTGGCAATGGAGCCAACGTCGCTTCTTGTTACACTGTGCTATACGGTAAAAGCTACGACGAATATTTGCAATCGCTCGCACTTTTCAATGGTTTCGC
GAACGTGGACGcacagctcgctgctgtacTTCACAGTGCAGTGAATGTTTTTGCATGTCTGCCACCGACGCGTCCAGATTTGCCAGtgtccttcttcagc
aagttCCTCTTTTCCGAGGAGTACCTGCGTAAGGTCGACATGAACTTAGCGCTCAGCATCTACACAGCCGTGACCAATGCCATCACGCTTGATGGTCGTA
TTCGCTTATGCCGCGGAGCACTCCGCCACGTGGATCTCAGCTCGCAACTTGGAGAGATCGACGTGCCGCTTGTTCTTGTGCAGTCTGTGGAAAACACGCT
TGTATCTCCCACAAATGTCGACCCATTCCTTCAAGGTCGGGCCAGCATACAGCACGTGTGGTCTCATCAGCAACCACATACCAGTGACTTGCGTTCCAAG
ACCCGTGCTCAGTTGAGGAAAGCTTTAGCGACACCCAACAGCGCATTTGTATCATGGCTCCGAGCCGGACATGAGCTCCGCCAGGAAGCGAAAGGCTACG
TCACAGAGGTGATTGAAATGCTTGTGAACTGCCAAATGGAGCCATCGGAGAAAGAGCGGATAGCTGCGCAGGACTCCGACGAGCACCAAACAGCAACTAC
AAAggagcaagagcagcagaaaACAGCGGCGAGAAAGGAGTCAACGGCTCGGCAAACCATCGTGAGCAAACCTGTCGAGCCTTCGACAAAAAGTACGCTT
GATTCCCCAGTGGCGGAGTGCCAACCACGAGCGAACCCGTCGTCCCTGCAGCCCAGCAAGTCTCCGTACGATCTTCAGCTTGAAAAGTCCGAACGTGCTT
TCAAGGAGGCACAACGGACACATGAAGCTCAAAAGGCTGCGTACGAGAAGAAAaagtggctgcagcagcaacaacaagagCAGATTCCGGGCGAGCCTCC
GGTTGAAACTCCAGTCACAGCAGTGTTAATGACAAGGTCGACGACTGAGGCTACGAACATGCCTGTGCCcatggccgtgctgctgcctcctgctcttcct
cctgcaGTAAAACTGCATCCACAGCTACCGTCGAACGATCGCGACGAAGGCAAACGACGGCACTATTCCCAGCAGAACGCAGGGAGCTATGGTACGCAGC
TAGACGACGACATCCACAGCGTGCGAGCCAAAATTCgtgccgaagaagaacgccTTGAGAAGGAAgccgacgagcagcgtcAAAAACACCGCGATGCGAC
TGAGGAACGCAtggctgcgctgcgagaGGAGCAAGAACGGAGACGACGTGAATGGGAACTGGAGGATCGCGAACGACTGGCAGCTCTCGAGGCACAATTG
CAGGCTCAACAGACTGAGCGGCTCGCCGCCTCGCAACATCGAGATCTGGAGCAGCTTGTAAAGGACGAGGCTGTACTCGCTGCAGTCACTGAACCACCGT
CATCTGCACCATTGCTAACACTGGAAGCGTCCGTCGATATGCCCACTTCCTCGACTGCGTTGTTGGCTCCGTCTGTGGAGGAAGTGCGGCAAAAGATTCG
AGAGCAGCCAGAACTCCCGAGTATgttcgaccagctcgaggcAGAAGAGCAGGCTCGCAAACGGCGAGAGCAGAAACGACGAGCCCTTGGTCCTGGTCTA
GTGGCCGGCAGTCATCTAACCGGGGAGCAGTATGACGAAGTGCGTTCGTCACTCCAGCAAAACTTCCGGGAAGATACTCGAGCCAACGAGTCCAACATGA
AGCGGGAGCTAAGGCGAAGGCGTGACGCTCAAGCTACGCGAGTGCAGAAGTACATGCGTCGGTTCTTGGCCACGCGTCGAGTCGATCGGATGCGCCGTGA
AAGGCAGCAGGAGCGTGTCAAAAACTTCGCTGGTGGAGAAATCGTGCGGATAGCTCGGGGCCGACTAGGTCGTCGACGATTCCGGCGGTtgcgcaaggag
aaggaggaggcagcaAGACAATTGCACGCCGCAACGCGCATCGAGACCGTCTTCCGGGGCTTCCATTGTCGGGTGGCATACCGCGCAAAGCTACGAGAAA
GCAAGGCGCGCATGCTGGAGCGGGTGTTTCGTGGTCACCTTGGGCGCAACCGTGCTCGGAGACTGCGCGAGGAGCAAGAACGACGCCGCTTTCAGGACCG
AAATGCTGCCAAGTTGCAAGCAACGTGGCGTATGTACGTCGACCGTGGCAAGTTCCTCAGTGCTCGGTTCTCcgagcttgctgcacttGAGATCCAGCGG
ATGTATCGCGGTCTATTGGggcgtcgagaagctgcacgcaAGAAACAGTGGCGTGACGCTCCGCCTGGAGCTGAAAGACTGGCGCTTGGGCTGCAATTGA
TTGAAGGCTCGAAGCAGGCGTTTGAACGGCAGCAGTGCGAGCTAGATGCCCTGCATCGCGCACAAGAGGCAGCGGAGCGCCAAGTGAGTGCCGTCCACAA
CGAACTGTGTGAAGCTGAGAAAGAGCTGGcagtgctggagcgcgaaCTCCAGgagatcgaccagctcgatGCGGACGTACGCGAACTGACACACGAAGCC
GAGCGACTACATGCCGGTGGTGTTGAAGGTCTGCTGCGGAACCACCGCTCCACATCTCAGCACCAACCCCTGGGCAATGGAGTACCTGAAGCTTCCTCCT
TGGTAGACAACGATGGTGGTGCACCGTACGACCTCGGAGCGGAAGATGCACTGGAATCGAAGGAGACTCTCAAGAAGCGCCAAGCCGACGCATATGCCGT
CGAGATGGCGCTCAGCATCAaacgcagcgagcgcgagaagaagaagcgcgacCTGGAGGCTGAATTTGCCGGTGCGTTCGATGAGTTGCAACGCAAGCGA
GAGGCATTagcagcgctggaagagcgccTCGCTGACATGGAGCAGACTCGCATGCGCAAGGATCGCGAGTTTGCACGTCTGCAGCGTCATCTCATGGAGC
TGTTGGAagagcagaagctggagctcgagaactTGCGCGAGAAGGGCATTGAGCTTGAGACTGCTACCGCGACgtcggccgcagcagcggcagcaacagc
agcgaaaGCGCGAGAGCACGAGGTGCGGTCACAGGCCATGTTCGAGTCCACAGAGGAGCTCATGAAGTTCCAGTTCATGTCTATGTCCTTGTCGTATTTC
AGCTCGCTCAACATGCTCAAGAATCTGCGCGACATCAACGCCGACACGACTGCGGCGGCCATCACAACCACCGCGGAGACCGCcgcaacggcggcggcgg
cagcagcggcagccaaCATCACGCCGGTCACTGCAGCTctcgcgaagaagaaggtcggTGGAGATGCCATGGGCGAGTTGCTCACTACGGTGGcccagcg
caagcagcaggagctcgcacagcagcgacgcgaagaagaggaggccCTGGCCCCCGGAAAGCAGCAACCGTTGCCCGAGGAATTGCGCGCTTGgacggtg
gacgacgtgggCCGATGGCTCGAGAGCTTGTCGCTGCCGCAGTACAAGGCTGCGTTCCGCGAAGGCGCCGTCGATGGCGACTTCCTCATCGAGCTTCGAG
CCGAAGACATGGCGGAAGTTCTGGGCGTATCCCACAAGCTTCACGTGCGTAAATTGCTAGCGGCCCGCAACAAATTGGTGCCCctgacggcggcggagcg
gGCGCAACTGGATGCTGTGAACCACGAGGCGAacgcagcgcgagcgcgtgggcaGGAACCGCCTGGCGGGGACGAGATCTCGTTGGAGGTTGACACCGTG
TTCTCGCAGGCGCGCAACGGACGGATGAAGCGGCTTGTTGAGAGCTTGGACGCTGGCTTCCcgctggacagcgaggacgacaagggcaacacgctgctgc
tgctcgcgtgcCAGAACGTGAACCAGAAAATGGTGGAGCTCCTGGTCGCTCGTCGAGCCAACGTCAACCACCGCAACGCGCAGGGCAACACCCCACTGCA
CTTTGCAATGGCGTACGACGGCGAAGGCGTCCTGGGCGAGTACCTGATCGCTcacggcgccgacgacacTATCGAAAACAACAGCGGCCTCACGCCCTAC
GACGGGCTCACAGCCGAGTAA