Transcript Name :
Phyra_g9599
Orientation:
(-)
Number of Exons:
6
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Sugar/inositol transporter2.5e-23PR00171
Sugar/inositol transporter2.5e-23PR00171
Sugar/inositol transporter2.5e-23PR00171
Sugar/inositol transporter2.5e-23PR00171
Sugar/inositol transporter2.5e-23PR00171
Profile scan predictionP-Valprediction_id
Reverse transcriptase12.75PS50878
Major facilitator superfamily domain41.706PS50850
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Major facilitator superfamily domainIPR020846
*** None ***
InsideOutsideTMhelix
1-577
578-600
601-620
621-643
644-652
653-675
676-679
680-697
698-706
707-729
730-741
742-764
765-860
861-883
884-889
890-912
913-921
922-944
945-955
956-975
976-984
985-1002
1003-1030
*** None ***
PositionContextScore
13SWKRFAR|EL0.586
*** None ***
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
membraneGO:0016020IEA
RNA-dependent DNA replicationGO:0006278IEA
*** None ***
*** None ***
Sequence
        9293 bases(100 bases per row)
TGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTG
TGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTC
AAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGA
TTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAA
TGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAG
CTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGA
GAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCA
GGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATT
CACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACC
TGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAA
TGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGC
CCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGA
TCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGT
GATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAA
AGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAAT
GGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGAT
TATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATG
ATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCG
TGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAG
TACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCA
AGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTC
CATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCT
GCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGG
ATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAAC
AGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAAC
AACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAA
GTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCA
TGGCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTG
AACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGA
AGCTGAATGCCGATAACATCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACTCAGAACCTAGCTAAACATGCAGTTTC
CGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATG
CGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGAC
GCGCTTCGAGACGCCAGAGAGTCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTTAACAAGCTCAGCTCC
TGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCC
CCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTGTTGGTCATCGGAACCAGACCCAGGTCCGGTTCATTTTCGTATTCG
TTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGGAATGTCCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCGC
CACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGC
CTGAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGGACGTGTACCCGTTGACGTCCCGCTCGGTGATGCGTACTGCTCCGGGTAGCAGT
ACTCACAAGCAGTGTCATAAGGCACTGCGCAAGGAAGTCCAATACCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCGTA
GCGCTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAAGGCACTCCAACTTTGACAAAGTGCCTGCCACTCG
GGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTTAACGGATCAA
AGTGTACTCGCTTCGCGACGTCATCGTCAACGATGGCGTTGCACGAATACAGCGCGTACAGATTCGGTGGCGCGGTCGCACCGAATCGGCTGCCGATCTC
AGACTGAGACGGCATCCACGGCTCGCGCACTGGCTCAGTGCGCGAGGCCGCAACAACAGCGGATGGAGCAGAGTCATCTCCATCCCGCGGAGTCGTAAGG
CTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCTCGAAGCGTTCGGGTCGTCCTCGCGTGGACGACGCAGACCCACATTGGG
GTCAGTGTGGCCCGGAGACAAGGTGTCCTTGTCTCCTTCGAGTTCCCCCCCTCGACTTCGCTTCCGTAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGT
AGATACCCACTCCGGTTTCGACAGCAATGATCTTGCCTGTCTTGTTTCGGATGGCATGTTTCTCATGCCATCTCGAGTGGTATCCAGCAACAGAGAGGCG
ACTCTCTGTTGCCGCGCTTGTCGGCATCGCCGTCGAGGCGATGCCAGTAGCGGTCGTGGCTGAGGCAGCGGCCGTCGTCGCCTTGGAGGCGACGACAGCA
CTTGCTGTTGCCGAAGCGGCCGGCGTCTTGGACGAAGACGTCGTTGGCGTGCTCATTGGGAATGAGCACGTGTTCTCCCGAAGAAAATACGGATTGACGT
GTCGAGACCGGCACGTCAAATCCTAACGGGGGGATGGTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACAT
TCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGG
GTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGC
TTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATACTCCTACGCTTCCTCCTACACGTGCGCACAC
GTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACGCTGTCATCTGAGGCATCGCGGCTTGCTTCACTATCAGCGTCAAGCCGCTCGGGTGTGCT
CACCTGCATGTCCATGTCTACATCTACAAAGAACCCACCTTCAACCAAACACTATACTGTCAGCATAGCAATGAAACACAATACCTGTCACGTCGGCACC
CGTCGACGTATTCTTGTCACAGATACCATTTCAGCAGTGTCAGCATTGCTCGGTGCGTTCGTTCAGCATTACGTATAGCATCCTTGTCAGCATTGGCTAC
AACATGCACATTTTTCGTCAGTATACGAATCATGTCAGCACAATACGCATGTGCTATACCGTCCGCGTCTGCACCACTTTGCTCGGGCGATGCATCGTGT
GGCAACACAACCGGAGGCACTACACGACGTTCTTCAGTGTCTGCATCAAACACTGTTAGCTTGAGTTTACTCCATATCGTCCGAAATTATTCCCACCTTG
TACATTGTCGGATCCCCATACGTTACCGAACGACGATAGCTCACGGCGCCGATCTGCTGCATCCTGAGCGAGTTGCTTCTTTGTAGGTTTCTTCGGTTTG
GCCGGTGCTTTCGCCACAGCCTTGGCACCTCGTGCTTTCGGTCGCTTTGTTTTGGGCTCCTTCGCGTTTGCAGGTGCTCTCTTCTTGCGTGTAGTCACAG
ATGCTTGTGGGGTTGGTGTTTGCGTGGGATCTGACCAGCAACAAGGAACAACACGGTCAGCTACAACACAACACCGCCATCATGCTAAACCTTACCAGCG
TACTCGCTGTGGGGGCGCACCATAACGTTTTTGATGAGGAGGCGCTCGCACAGCTGCTTGTCGGTTTTCACGTAGGCGAGTAGCGTATCCTCCCCGTTGA
AGTAGTCGATCCCTTCCTTTCCCCCACGAAGCTTGCACCCGGGTTTCACGTAGTTTGAGCTAAGACATAATAAAAATACGTCAGTTGCATATCTGCACAG
ACATATAAAGGTCACGTACTGGATCTGGAGGCCTTTCGCTGGCTTCCACGTCCAGCCATCTTTCCGGAGCAGCGGCCACACCGCATTGAAATCCATCACG
AACGCCATTTCTTCTTCTTGCCGTGAAATGAAGAATGACTGGCAGCGGCAAAAAGGGGGACCTAAATTTGTTTTTTTGGAAAATTCAGTCCACGCTTTAT
GCGCGGTAGTGCAAACCACATGCTATTGACGTCCAATAGGGTGCCTCCATTACAACACGTGGACCAATCATATCCCTCGTATATATGGGAAGGGACGAAG
CTTGCGTTTTGCGAAAATAAAGGCATAGTGAAATCAAGTTATTCTTATGCTGACCGAACAGCATAAAACCGTGTTGCAAGGCTCCGCGGCCAAGGGGTTA
ATTGTACACTGGTTAGTGTTAGTTTACAATTAGCGTTATTAGCGTGAGCCTTCACAGAAGCCGGCCTCACAAATAATGTTAATAACTCTAATCGCTGTGG
TTAGTAGAACACTTCCTATAATGTACACGAGGAAAGATTTATGGCAGAACTCTACGCAAAATGTGTAAAAAAAAACAGCTCTGCCCGCTTAAAGAAAAAT
GGTTTCCGGTACGGTTTTTTGTGATGGATTCTCTATTCCGATTGGCTGTTGATGGTGTCCGCTTCAACAATTGTTATACAGTACTGTAGTACCTAGTCTA
CGCGATTGTCGTACCAGGCAGGCTTCCAGGCTGAAGGCCTCCCAATTTGAGCTCTCAATGCTCATCAGATGAACAGATGCATGTATTGCACTCACTCTTG
CCAAGCACTCTGTCGCGCTGTCGATCGCTCATTTAGTTTCCGTTGAATCTGGCAGAGGCGTTGCTGTAGCTTGAGTCAACTGCTACGTCAGTCGAGTCGG
GCGGGTTCTTTTTCGAACGCGCAGGTGAGTTGTCGTCGCTACCGAGTCCCTCGCACGTTTCTTCTCTGCCTCCTTGGCATGCCGGTGCTGGCAGAACCGC
CACGTACGCTGGGGCTTGCCTTGGTGTCACCAAGTTGGTGATGCATCCAAGCGTTCGCTTGCCAAAAGAGGGGGCTCTTGCAAAGATTCGTTTCGTCAAG
CATACAAACATCTATATGCGCAGCTATCAAATCTGAATGGAAGATCCAGCTACATAAATCGCTTCACTATTGCCAAACTAACAGAGCCACGTTGAACCCG
CGGCCGAGCCCGCGTGCTGTCGTTACGCGACCGTCGCCGATCTTGCTCGACACAACCGTACGAGCCACTTGGCTCATTCGCCTTCTCGCTCTTAAGACTC
CAGTCGTGTTCGGGGTGATCCTACAGACTCGAGGAACGCGGTAGACAAGATGCAGCACTCGCAGAGCGATGTGGCGCTGGGCACCAACGGTAGCTGGGCC
GACCTCAAGATCGCCGAGGGGCTCAAGAAGCGCAGCAACACGGCGCAGAACCTCCAGTTCTATGGTAAGGCCACCGCTGTTGAGGATGAATGGCCGCCCG
GTCTCACTCATATGGTTCAATCTGTGACGTGTGACAACAGTCGAGGAGCAGAAGCGTCTGTACCAGGAGCTGCCCTTCTCGGTGCTGCCGGGCATGCGGC
GGCAGTCCTTCCAGCGCGAGCGCAGCTTCTCCAACCTCAAGTCGCGCAGCTCCTGGGGGAGTTTCACCAACCTTGTGGCCAGAGGAGAAGACCAGCCGCT
GCTCGGAGCCGACGATGAGTTCCCTGAGCCGGGGTACACCTACCCGTTGCTGCTGAGCTGTGGTGTGGCGCTAATGAGCGCCTTCCAGTTCGGCTACAAC
ACGGGCGTGACGGGTGGTATCAACCCTGACATCATCTTCCCCGGCCACTCTGACATGCAGTGGGCTATCTGTGTGTCCATTTTTGCTGTGGGTGGCCCTA
TCGGGTCGCTCACGGCGGGCCAAGTGAGCACGGTCCTGGGCCGTAAGAAGGCGCTACTGGTGGACTCGTTCCTCTTCATTATCGCAGGCGCCATCATGGC
TCTGTCTGTCAACATCTACGCTCTCATTTTGGGTCGCTTCCTAGTGGGCTTCGCCTCGGGAACTGTAAGTGTTGTGGTGCCGCTGTATCTTGGCGAGCTC
GCGCCGCCCAATCTACGTGGCGCTTTGGGTACGGGCTACCAGTTGTTTATGGTCATGGGCATATTAGCTGCTGACCTGCTGGCGTTTAGCTACTCTGGAG
AAAGCCACGGCCTTGCGCAGCCTGGTTGGCGTTTGCTCTTTGGTTTCACGGCCGTTCCGGGAATTCTGCAACTGGCCCTGGCATCGCTTCTGACGGAGAG
TCCGCGTTGGCTTCTGACCAAGAACAAGCCCAAAGAGGCGGCCGACATTCTGCGCCGGTTGCGCGGCTCCAACGACGTGTACGAGGAAATCGACAGCATT
TGCTCAGCCAGCGACAATGAATCCGGTGCCAACACGGGCATTTGGGATGTGCTCAGGGACCGTAGCATTCGCTTCCCGCTCGTGGCAGCTGTGGTGCTGC
AGGTCGCGCAGCAGTTTAGCGGTATCAACGCCGTCATGTTCTACGCTAGCTCGTTCTTTAAGAACGTGGGTCTGAAGGACCCGCTGGTGGGTGCGACGCT
GGTGTATACGGTGAACGTTATCTCGACGGGCGTTGCCCTTGTGCTTATGGATACGGCTGGTCGTCGACCGCTGCTGATCTACTCGGCTGTGGGCATGATC
TTCTCCAGCATCGTGCTGACTCTAGGTTTGATGAACGTGTTGCCGTTTGCAAGTATGGCCAGTGTGGGTGGTGTCATGTGCTTCGTGTGGTTCTTTGAGA
TTGGCCTGGGCCCCATTCCTTGGCTGATTGTGGCCGAGATGTTCCCGGCCAAGCCGCGCCCGACGGCCATGAGCATTGCCACCATGGTGAACTGGTCGTG
CAGTTTCTTGGTTGGACTCATGTTCCCAACCATGCAGCGTGAGCTGGGCGAGTACACGTTCGTGCCGTTTGGTGTAGCGCTGTGCATGGCGCTCGCCTTC
ACACTCAAGTATGTGCCTGAGACGAAGGGTAAGACCATTCAGGAAATCCAGGATGAGCTTCAGCTAAAGCAGCAGAAGTCCATGGAAGTCTAG