Transcript Name :
Phypl_g44
Orientation:
(+)
Number of Exons:
9
Description :
tRNA (guanineN(7))methyltransferase putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-168
465-685
818-837
918-966
1036-1083
192-441
706-794
861-894
990-1012
1104-1231
169-191
442-464
686-705
795-817
838-860
895-917
967-989
1013-1035
1084-1103
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4285 bases(100 bases per row)
ATGACGGCTCGCAACCTTCAACCTGCTGCAAACCGACCTCCGCCGGAACGCCGTCGTAGTGACGCTGCGACCTCGACCAAGACCAGCGAAGTAAGCTCGG
CCGAACTTGTCGTGGAGAACTCGCAGCTCTTGGCAGCCCCTCGGAGGCTGGCAAACGATTTTGGAGATGTTACAGCATTGGAAGAAGGCCAACTGCAGGG
TGGCAAGAGCAAGCTTGTCATGATGTCGCCTCGACTGGATGCGCAGCTAGGTGGCTACCCACCGGATTGTGGCACCAAGAGACTCAAGTATCTGTCGTAT
GCCAAAGTCCTGCGTGATCGCGGGACGACGCACCCGATGCGTTATTCGAGCACCCGAGTGGATGCGCTGGGGTTTGCCATGCCCGAGCGTTACCCGTTGT
TCGCCACGGACTTTGGCGCGCACTCCTTCCACCACCTCCCCACAGACTCGACTGTGCTGAGCCAGTATGGTCTTGGCATCGCATTGTACTTCAAGTATCT
CAAGGTCCTCACGTGGCTCTTCCTCTTGCTTGTGGTGCTGAGCGCTCCTGCTCTCGCGGTCTACgtcatcggcggcggcacttCCTTTGCGGAGCTCACT
TCTCTCGCGCGGCAGGACCTGCCGTCCGTCCTGGGCGTCACCAGTATTGGTCACCTCagcgaggccagcagcgtgtgcgACCAGGCTCTCGAACACACGG
AGCTGTCGCTCACGTGCTCAGCTGGTGAGCTCGGCTTTGTGAAAGCGGTGTATTCGACGTACGATTCCCAGGGGAGTTGCTCGTGTCCGGAGCGCAACAA
AGTCGCCGAGGGCTCCGGTAAATGTCGCGGTGACCCTCAAGGATCTGCTTGTCCCGCCGACGGAGCAGGTTGTTTTCTAGGCGCCCACCCGGTCTCGCTT
CGGCCTTGCTGCTCCTTTTCACGCCACGAAACGACCAAGAGCCCGCTCTTTGAGGACATGCGCATCCGAGAAAGTGGCGGCTGTGGCTCGAACACAGCCC
AACAAATAGTCGAAGGGCTGTGTCTGGGGAAGAAAAGCTGCACCCTCAACATCAGTGAGGCGGCCACGTACGCATGGGAACCTGACGCCAACCACGGGAC
AAACTGCTCGAAAGCTCCAACAAGCGTCACGATCGACAGCGTTGCGAACCTCACAAAGGAGGTTTGTCAAGCACAGCtgaacgacgacagcgattACTCA
ACGTGTGATGCCCATAAGCCCCGTGCGCTGATTGTGTACGGGAGGTGCTTCACCACGCGTATCGACTTGTCCGGTGCGTGGAGCCTCAAGATCATCGGCT
GGGACTCCATGAGTGTAAGAACTACAGAAGTGTGCATTTTTGTTATTGTTTTAACGGTgtatgttttttttttaatgtAGCGGCGGGAGTTCTTAGGACT
CGCGGTGGGATGCGACATTGCGTGTAGCCTCGCGTTCTTCGGGGTTGTCATTTGGCTACGACGCAAGGAAAAGGAAACCGTAGACCGCATTACCCAGAAT
CAAGTCAAGGCTCTCGACTACActgtccagctcgtcaacCTTCCTCACCATGATGACCTCAACTTGCTGCGTCAGGAGGTGAGAAAAAAAATGGCACGGT
TTGATTTGTTTTTCATGCCACAGCTTCTAACTCGattttttgtgtgtgtgtttaCTAGATTCGCCTGCATCTCGAGGCTGTCTTGAGCAATGCGCCACCA
TTTGCAGCGGATCTCGACCGCATTCGTGTGGCCGACGTCCAATTCGGCAAAAGCGCCTCTCGCCAACTTCGTCTACTCAGTCGCCGTGGTGTCATCGTTC
GCCGTCTGGAAatcgctcagcagcgtcacgagaagctgcagcttctgcatgGACGACTCAATGAGCGCGTGTACGCCAGACGGGAGCGACGTCACTTGCA
ATCGATACACAAACTGGAGACGAAGCTCCACCGCTTCAACGTCAAGCTGGGGCAGTGGCACGTCCGTCACAAGAGATACAATATCTCGCAAGCCGTGACT
GCTTTCGTGACattcgaggaagaggaagggGTCCACCGCTGTCTGCAAGAATACCCGGACCTTGGCTGGTTCCACCGCCTCTTCCAGCCGTACTACAAGC
GCCTACAAGGCAAACGCCTTCGGTTCCGGCCGGCTCCGGACCCGACCGATATTATCTGGGAAAATCTGCACCACCCGTTCGTTGAGAGGATGTTCCGGCA
ACTGGTGCGTTCACGAGGAGTCTGACTGTTTGCTTTCCATCTAACCCACATATGTACTCTTATGTGTGTGGCAGATCGTGGCATTAATCACGCTAGCTGT
GTTGTTCCTGAGCTTCGTACTCATTTTCGTGGCGAAGGAGCAGAAAAACAAGCTCGAGCGGCAATTTGGACGACCAACTAGCTGTCCGACGGGAGTTCTC
AAGACGGATGTCGTTCAAGACGAGCTGAACAAAGCTTCTGGGCTTGTACCGTACAAGGCCCTCGTCGAGTGCTACTGCAAAAGCTTCCTCGTTGATCAGT
AAGTTCGTTCATCGTAGCATGAATATTTCGTCCGGGTCTAACATAGATTCGCTCTGTCTACTGTACTTGTCTTGATAACAGTTCCTTCCGAAGCATGATG
TACGAAAGCTTCTACAACTCGGACACGGGGGAGGAGGAAATGCTTTGTCGGTCGTGGGCAACAACGTTTGTGACGACCCAGGTCCTGTCAATCGCTTCGG
TTCTACTGGTCGTGGCTGTGAACTTGATACTGGCACGTATCCTAAACGGGCTTGTCGCCTTGGAGAAACATCACACAGAGTCCAGTCTGGTGGTGTCCCG
AGTTACGAAAGTCTTCGTCGCCCAATTTTGCAACACCGCACTACTCATGCTCGTCATCAATGCGAATGCCAACTACTTCTCCGAGACGGGCACAAGTGCT
GCAAGCTTTTCACTGGGGGCGTTGCACATTCTTAACGGCGAGTACTCGGACTTCTCAGCAGCCTGGTACAATGATgtgggcgtggcgctcatgcTCACCA
TGATCGTCAACTCGTTCAGTACACACGCGTATCTCTTGGCAAACTACATCATGCTCAAGGCTCGCCGCTTCGTGGACCGAGGATATTCTTTCGATCACTC
CTTGACAAAGCAGGACACGCAGCGTGATCTCGAAGCGCTCTACCGCGGACCCAAGTTCGATCTCGCTGCGCGTTACGCCCAATCACTCACCTCCACCTTC
ATCACGTATATGGTACGTAGTTGTGTTTCCAGCTGAGGCAGTACTGTGCAAATCCTGATACGATTCTGTTCATTCTCTTTGTAGTTCTCAGCCGGCATGC
CACTGCTCCATTTCATTGGCTTCGGAGCAATGATCATGACGTACTGGGCCGACAAATTCAGTAAGTGACGGTCTCATCAAACCTTTTTGTCAGGGGGCAG
CAACTAACACTGCAACATTGCACAGCATTTCTTCGGATTGCTCGGTCGCCACCGCTGTACGACAGCAAATTAGCCACGGCAGCAGGTTCGCTGCTCCCAT
TCGCAGTGTTAATGCACTGCCTCCTTGCCATGTGGATGTTCTCCAACGACCGCATCTTCGAGTCCGAAAGTGACGAAAcgctcgaggacgccaaCGTGAA
CAGCACGTACAGCCCTGGTGACGGCATTCCGCTGTTCGACGCAGCCCGCCGAGGCCAGTTGATTTCCCGTGTCACGCGGCCACAAGTCGTTGTCCTtttc
gccttcttcgtggctGGCTGCACCATCGTGGTCATGCGCACCGTGCTTTTTGAGTACGTGCCAGCGCTGATCCGCAGTGTCTTCCCAACCCTCGCTCGTC
TACTGGAGAAGCCTCGTGTTGCCAAGGGTATTCCAAACTACTTCGACGGTGAGCGCACAGCATTGATTTCTTGCGTGCTTCGTGTCAGTCTCCAACcttt
tttgttgttgccaTGTCCGCAGCTATTCCGACGTCGTGTCTGCAGGAAAAACTTGCAGCTACAGGCGGCACTCAACAACTTCTCCGACCGGATTTACGTG
CCAAGTACGAACGTGCTCTGCTAAACCGCGTGGCAGACGACGAAGCGTTGTCGAAAATGCGCTCCAAGCGCTCTTTGTCCGCGACGGAACGCTTCAACCA
GGCAAACTGGATCGTCGGCTGTCATTCCTATGGTACATTTTTGTCTTCGCTCACTGCCGGCGAGCAATAACTAATGCGTTGTTGGTTCTTCTTGCACAGC
CATTAGCGACAACAAGGAGTACGTTGCCAAGCTCGCCATCGACTCGCACCTTTCAGAAGAAATTCCACTCGACCAGGTCTTCTAG