Transcript Name :
Phypl_g10
Orientation:
(+)
Number of Exons:
14
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pleckstrin homology domain8.535PS50003
Guanine-nucleotide dissociation stimulator CDC2520.646PS50009
Leucine-rich repeat7.127PS51450
Leucine-rich repeat5.471PS51450
Leucine-rich repeat4.763PS51450
Protein kinase domain27.128PS50011
HmmSmart predictionP-Valprediction_id
Pleckstrin homology domain5.8SM00233
Guanine-nucleotide dissociation stimulator CDC254.6SM00147
Leucine-rich repeat, typical subtype76SM00369
Leucine-rich repeat, typical subtype55SM00369
Leucine-rich repeat, typical subtype5.4SM00369
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pleckstrin homology domainIPR001849
Leucine-rich repeat, typical subtypeIPR003591
*** None ***
InsideOutsideTMhelix
2163-2494
1-2139
2140-2162
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein bindingGO:0005515IEA
guanyl-nucleotide exchange factor activityGO:0005085IEA
intracellularGO:0005622IEA
protein phosphorylationGO:0006468IEA
small GTPase mediated signal transductionGO:0007264IEA
*** None ***
*** None ***
Sequence
        9525 bases(100 bases per row)
ATGGACGACATCGAGGCGCTCATGCCCCGCACCAAGTGCGTGTCCCTTCCCCCCTCCGCCCTCCCTCGCGCTGCGATAGCGACGCAAATGCACTAATTAT
TAAGCCTTCGTATTGTGTAGGGCGGCCAATGACCGCGCGCCCGtcgacaaggccaagctgaagcagtacatggccaccacgaacgcGCCCCACAGCGTCG
GAACGTaaggagaagacgcgctcACGGCCTAGCGACATGGACGACAACGTACTTATATTATTTattgctgcagtcgctcgggcgtcgtggtgcgcgacga
cgtgcgcaaGGACGCGCAGGGATTTGAAGACATCGACGACTTTTGGGTCGATGAGGACTCGATGCAGGACGActcggtggacgacgacgacgactgtgCG
TGCCAAAGATGCTGCAACACcctggaggtggtggtgctgacgctgacgctggctGTGGTTTCTCGGGTGGACAGCGCTGACGGTGTCGGACAAGGAGTCG
GCGGACACGTCGGGGGACCTCTCGGAGCCGAGCGAGCAtgaggtggagctgccggaCATCGACAGCCCCACTATAAGCGACCGAGAGAGCATGGACATCG
AGGCTGGCCCGATcccgtcgcgctcgcgctcgcagaGAAGCAGTGGCAGAGTGGAGagggaggagaagaaggatgAGGGGGAGGACGCGCCGCCCTCTCC
TGTGCGGAGTGATGCGTCGTTTGATTTCGGCGGATCGCCTCATGGCTCCGTGGATATGGACGCTGATGCGAACGTCACGGTCCGTGATCGACGCAAGAAG
TCTACTGGGAAGGACGCTGACAAGGCGAAGGCTCGTCGGCGGAAATCGTTTGGCGGACGTGGCTTTGACGAGGACATGGCCAGCCCGTTCTCGATGAACG
AGGGCCCAGTGACGCCAATGTCGAATAGTACGTTGTGTGTTGCTTGATGTGGAGCTTTTCCGCATCAACGTATCTTGTTTGTGCTGACGTGTTGTGTCCT
TCACTATGGCACCTACAGCAAGCGACCGCACCTTGAAGTCTATCCCATCGTTCTCGGACAAGAACTCACTCTCGCCGAACATCAGCAAGGAACTATTCAC
GAAAGATGGCTCTGGCAGCGATGCCAGCGAGAAAAAGCCTAGGAAAAAGCAGGCGAAAGGAAAGAAGGCGAAAAAGACAACTAGCGGGAAGCAATCGACT
GGTGATGCGAAGCAGCGTCGAATCCGGCCGACGGGTAAGTACGGTTATCGGACCACGGCGCCTGCAATAGATACCTCGATCCAGTCGGTACAGacagacg
acgacaatgaCGAATCCTTTGAGGCTCGGAACGACTCTGGGGGCGAGActggcgacgacagcttTTACAACGAGCCTGACGCTCCTACTGGTCGGGTTCG
CGACAGGTTGCCTGATGCCTCAAAAATTTtggatgaggaggaggcgaaTGGCGATGCTTGGGATGGCAGCGGCTTGCGTCGATCGAAGCGAAGGCGCTTC
AAACCGCTTGCCTGGTTCAAGAGTGAGCACATGGTGTACGAACGCACTTTCGTTGGCGTGGGCACAGTGATGCCCACGGTTGTGGGCGTCGAGCGCTTGG
GGCTTGACTCCCCGACGGCCAAACGTACAAAGGCCAAGCCACCGTCGAAAAGGACCAACAACAGCAGAGCGTTGTCTTTGAAGGAGTTACCTAAGGACGT
CCAAAAGCGAATTGTGGAAAGCGAATGGGCGACGCTCTTCGACGGCCAGGCAGGCTGCATGAACGATCTGAACATTATCTGCCGCTCCAGCGAGATCCGC
CTGCGCAAGCTCCCCACGGAGGAGAGGGGTGGTGCGGTGGTGCACGCGTACGCAGGACAGAGTTTCAACCTGTTCAGCCCGTCTCCGTTTGCTCGGTGGA
TCTCGGGGCGCGTCGTGTTGCCGCCCGGGGCGTGGAAGGAGCCCGAGGGCGTTGGTCAAGCGGTCCAGTTGTTCTACGTGACGGGGTGCCAGCCGAAGTC
GCtcgagttggcgctggctcctgagatcgacgacgacttcttcacgAGCAAGCACACGACGCACTTTTTGCTCAGTCCGGGCGACGAGTTCTACGTGCCG
CCTGGCAATGTGTACTACGTGAAGAACCACTCGAGTTCCGCAGACTGCGACCTGCGGTTTACAATCTTGAAGCCCGAAGCGCTGCCCATGCCGGATGACA
ACAACGAGTCGGACgcagagcaggagcaggagcaggagcaagagaaggaggagccGACGACCACGGAGTCCAAGCCGGACGCCACCGAGGCTGCGAGCAG
CCCGCTCAAGCGCAAacgcaagcgcgaggagggCGCGGACGTGGACGCAGGCGCAGACTCCGACTCAGTCTAGGGCCGTGCACATACATTCTAGCAGCAG
TCTCCTTTATTCAGTACAATCGTTTCGTGTGCAATGGTGACATGCAGTAGGACGAAGAGCCGGAAAAGTGTCTGACGCCCTGATAGTCGGTGCTTTATCC
GGCGCTATGATTACCCTCTGACAAGTTCATTGACAGCGTGGTGCTTCTGTCGCGAGACATCGCAGTAAGTGCACGCGAGACATCGCGTGCACTTACTGGA
GCCCTTGCCCTGCCCCCAGCCGCCGCTTTCGAGATGTCCACACGCTCCGACGCTGGGCGATTGGCATCACGGGCAATACGTGCCATTATCGCAGAAAAAA
AATGGCGCGATTCAGGTtttgcgtcgtcgtcaactCGAGCGGGGCTCTGCTGTAAAAGCAGATGGAGTGGCGCCTCGATATGGATAGGTGAGCCCGCCCA
GCTGCCGGGTCTAAGAATACGCGTGGGTCGTGGGTCGGTGTCTTGATGTGGCAGGCCGAGACGTTCGTGCGCACCAGAGTGGAAGAGATTGTCAGTGGTA
AAGGGACTGAACGTCGGACAGCCAGAAGACGAGCAGGTGTGGCGCTGCCTGCCCTCTACTGCCCTCCCGATTGCTTATCGATCCCCACTACAGCTTCGAT
ACGCGCCATGGACCcggccgcgtcgtcgtccaagtGCGTCCGTAGTGCGAGCGCTTTGCTTAATGGTTGCTCTGCGATTCACTGACGCGTTGGACTGCTA
CAGGATGGACGAGATCTTCGAGACCATCAAGGAAggcagcgtcgccgtccgGGGGCACTTCATGGTACGATCCGCGCACCGTTCGGTTGAGAGAAGATCT
CGCAGCACGGTCGATAGACGCATTGAGGTCTCACTAGGCGGTATTTTGTTTTGCGTTGTAGTGGCGTGACCGCTACGTTGTTATCAAGCCGGGCGAGATG
ATCATCCGTCGCCGACGAGACGGCTCGATTAAAGCCAAGGTTGGTCTTGATGCAGCCTGTTGCTACGCAAAGCGCCGTAGTACTCACACAACTCTTGTTG
TTTTGTGTGCTTTTCTGCCCAGATCGATCTGCTCGAAACCAACATCAAGCTGACCTTTCTCGGCGGGCAGTCGTTGCTTACGATTTCCATGCACGGGCGG
GATACCGTGTTTGACTTTCGGTCGACTGTCACGCGCGACGAGTGGATCAGTGCCATTGTCAGTGCCCAGGACCGCCCAGGTTCCGATGTGGATTGCGACG
AGGACGGAACAGAAGTGCTCTCCGGCGATGAAACAGACGACCACGACGTACACAAGCGCAGCTCGATGACAAGCCTGGGGACTGAAAAGAGCGACACGAT
GGATGAGGACAGCGAAGGCTACAACGACGCTCTGCTTGCGTTGCAGAGCGTGCGTGATTCCGTCATGCAGTGCCATCTATCGATGGGGGCAGCTGAGATC
GATACTTTTGGTCATCCCCGCGACAATCCGGCGGTGCCAATATTCACGAAGGCCGCGCCCTCGCTTCGACGAGTGCAAAGTgcgaagcgcagcgaggagg
agctaCGACAGAAGCGGCTCCGATCACTGTTGACAATGATTGAGAGCATGCCGCATGGCGGACGCGTGGTGCTTTTGCACCTTGGAGTGGTAGCGTCTGT
AGGTATCACTGTCGGCGAtatgctgctggcgctgggaGAAAAGCAGCGGGATAACCCACGCCGTGGTTCCTTCACACCGCGCACTCTCAGCACGCAGAAG
CACAACGTGGCCGCATTTGTTCGCGACATTCTGTTCCACCCTATTTATtccaagcgcgaggaggtgAACACAGAGATTGTTCAGGGCCTCATTGATTTGT
TCTTCCCTCATTGCCGATTGAGGAGGTTTAGCGACGACACGGAATGGCAACAGGTCCAACCAGTGCCGGCTGGCTATGCGGACAATGCATACAGAGTCAC
AGCAAAGAGTGaaaacgacgccgacgtTGGCACCTCAACGATTGCGGTGCCTGCCACCCCGACCGCTATGCCACCAACTCCAACTCCAGCATCAAGACCC
CCGCAGAGGAGAAAGCGACGCAACCACTCGTTCCCGAACTTGGGTGGCATTTCTCAACTTGCCAAAAGCAAGGGCTTGTTACCAACATCAGCAGATGACA
ACGACAGATCCATCAACTCGAGGAAGTGCGAGGAAGGAGGCACCCAACGCCTACGAGATAATTTATCGGTCCTGTTTGCTCCATTGACCCCGTCCGCAGG
CCCTAGCGGAGGAGGTAGAGAGCCCGCCACCCCTCTTTTGAGCCCGAGCACCTTGTTCGACTCCAGCTCATCCGAGGAGCTCGACCTCATTGGTGAAGAT
GTTCCGCTCCCTGTGCCTCTGCGAAGTTTGCTGTGGGAGATGTCGTGCTCAGAGATGGCAGAACAGCTCACGCTCTTTCACCACTCACAGCTTACGAATG
TGTATCCGTGGCAGTTCTTGCACCACCCCAAACAAGCCGCCAAGGAGCTTACGGATCACTTTAACCGGTTGGTGGCGTATTTCGTGTGGTCGGTGCTGGT
CGAGGACTCGCCCAAGGAGCGCGCTGAGGTCATCGAGGACATCATCTCCATTGCTATGGCTGCAAGTGCACCACCGCTGAATAATTTCCACCTGGTCATG
GCCTGCGTGGGCTGCCTCGGTGACACACCACTGATGTCTTCGCGAATGCCAACTACGTGGAAGAAGGTGCGTGCCAAATACAAAATGCGCCTCGGTGAGC
TGCGACGACTATGTGACCACACTGGTGGCTTTGAGAACTTACGGCGGAAGCAGAGTGCGGAAAGTGCTCGACCCGTGCTGTCCAGCAACGTATCAACTGC
TTCGACTATCCCATTCATCGGCGTCATTGGCGTCATGCTCGAGCGATTGCGCTCGACTAGCTACTTCACcgcgaagaagatgctggatctggagaagctc
gagcggcagTACATGGTGCTCAATGTACTAGAGAGCGCACTGCTCAAGCCTGCTCCACGACCTTGTCGGTCACCGCCGCGTGGAAagacagcagctccga
ctgAGACCGCTCCTGAAATGACAGCGCGTATGCAGCGGTTCTTTCGGACTCTCAGTATGGACTTCGCCACGCCTCGACTGCATCAGCTTCGCTCGCAGCA
AATTCTGGCGAACGAAACAAGCGCGACAAGCTCAGCATCCGCCTCTTTCGTACTCTCGGCGACTGTGAACGGGAGTAACAGGGGGGGCGTGCCGTTGGGA
GCAAGCCTTGCAACCAGCAGTTCACATGGATCCATAGGTCCGCACGAGGACTCTGGGCTGCCATTCGTGTCGTTCCGCGATATCTGCGTGTTGCTGGTCG
CAGTGCCGGAGATGCGCGAGCGGATGCAAATGGCTCTGGAAGCGCTGTTTGTGGACGGACGGCAGCCTGCGACGCAGTTCCTGCGCAAGTTTTGGCTCGA
CTTCAAGCAGAACGTGTGGATCTCGGGCGTAGGCCCCACGCTTCAGAGCGTGCGGCTCTGCGTGTCTGCTCTGTACCAGGAGGCCATGACGTACAAGGTC
ACGGAGCTCATGCAGATCAGCGGACTCGACGAGAACGCCAGTGACCTGCACGACACGGTGTACGCGAAGATcgtggtgctgacggtgcAGCCCATTTATC
TGAAGATCGTGTCCAAGGTTAAGCGCAACTTCGTCACGGAGGACGCGCATGCGTCcgctcggctgctgcagagcacCCCTCAGGTTGTCGTGGACACCAG
CAAGCCGACGATGCCGTggagcagttgcagctgcagctcccccgtcgagctgctggacctcGTGTGCCAATTGGTAGCGCTGCCTCGAGCCAGCATCACg
actgcagccgccgccgcgaccgaTCACCAGCTCGCAGcagtcgagctgctgggcgcgctgcggCACCAAGCTCGGCACACGCTCCTCGCCACGAACCCGG
TGAGCAGCCTGTACCTGATGAAGCAGGTCCTGGACCCGAAGTACCTGCCTCTCGCCCGGCGACAAGCGCTGGACGTGTTCGTCGCCGCAGTCACGTGGCT
GCGGAAGGAGCAGCGCCCCCATGAAGTTTCCCCAGAGCCATGCCATCCGTGACAGGCCGCAGTTTTCCCTATAAGGCCATTCCTCTCCAGAGGAAAGTTC
AGAGTATATTATATCGCGACGCTTGCGCGACTTGACAGATAGGGGTTAGCTCCATGTTGCCAATGGCAATGGCAATGACAAATTGGCATGGCAACTTGCC
ATGAGCCAAAAAGTATCCTGCGGTCGTGTGGTGCAGAGACGGGGGCGTCCCACTCGCTCGATTCTTCCCATTGGCTGAAAAACCACACAGTATCATTTCA
GCCCACATGGCTTCGTCATGTTGTCGATGGGACTGTCGCCGCGGAATGAGCGCGCACTCGCCCGCGGTGCATTGCCATTCACACGCGCCCCCCCCTCTCC
CTCTTCCCATCGGCAGTGCTAGGCAAGGCGCGCCGCGGCGTGTACCGGTAATTGCAGTCTCGTATCGCTTCATACTTCTAGGAGGGATTGGCCTGGTCTG
ACACTCGAGTATCCTCGCTCTGCGAACACCAACCGGTAAGGTAtcagccccccccccccccgcNccccccccccccccactcCATTCCCTCACTCTAATG
CAACCGCCTTCTCCCCCTCCTAGAGCCGGGTGTATCCATCTATGCGTCTGTGGTGGACTCTGGCGCTCGGCGCCTCGGGGCTGGTGAGTGACGCAgcgtc
cgccgccagctcctcgggTTCCAgtgccacgacgacgacgacgagcggTACGCTCAACACGCTgaccacgagctgcaacggcggctgcagcagcaacggg
GCCTGCGTGGTCGTGGGCCAATCCTCGGCCAACTCCATCAACTGCGTGAACGACACCAACTGCGTCACCTTGTCGTCGGGCCAGTCCGCGCTGTGCCTCG
acgccttcagctcgtcggccACCGAGTGGGTCTTCCAACCCGCCGAGAGCAACGACACTGCAGGCGTCGGCCCCTTTGAGCGCGtgggcctgctgcagct
cgacgaccATGTGACAGACGTGACGTTCAGGAAGGCAGACCAGGGAGAGGAGCCACTCTCCGGGTCACTGGAACTCGCGTCCATGAACGTCCAACCGGAC
GCCACACTGGACAAGGTGAGGTTCAAGAACTTGAGTCTGTCTGGACTGGACAGCGCCTTGCCGCTCAACAGCGTCAGAAGAATGTACGTGGCTCTGCAGC
TGTTCAAAGACAGCAAGGATCATCGAATGGGGGCTGACAACCGTTGCTCGATTTGGCTTGAGAACAGATATTTCAACAACTGTTCACTCAGTGAGATCCC
CAccgccgctgttgctggcgaCTCGGTTACCGCCATGTACGATGATCTACGGCACCAACAATTGTACAATCGAGATGTGTCTAATCATATTTGTTGTCTG
GCTACCTCAGTGACCTAGCTGGCAATGCCATCACCAAGGTGAACTCGGGCTTCCAAGACGAGACCTTCACTAACCTTACCTCGCTGTATGTACTGTCACC
AGTTCGTCCATTTCCTGCTGAGTTGTTGCTGACTGTTGTATTTTCCTCAATGCAGTGATTTATCATCGAATGCTCTGACAGACTTCGATCTTGTGGCAGA
AAATTTCCCAGCCATCACTACTTTGTGCGTACTATTTACTCGTCCTGGACTCAGATGTTTGGTGTTGGCACGCTGCTGATCGCTCATTGTTTGCTTCCAT
GTACTTACTGTTAGATATCTGAATGACAACTCGCTCAAAGCGGTTCCTGAGGTGGTTTTCAATCTGTCAAGGCTGCAGTTCctgacgctggtggacaacC
CCATCAATGCGTCGGATCTGACAGCGCAGCAGTTCACGTTCCTCGCCAAGTTGCAAATGTTTACGATCGATGGAACCACCAACACAAGCGCGTGCCCGAC
CACTGCAGTTCAGGTTGCGCTGAACGATTCGTTCACATTTTGCGTTGGAaacgacgaagacgtcgaacCTTCAAACATCACGGTCACCGagcagccagcg
acgacagtTCCTGCAACAACGGCGGACAAttcctcatcttcttcgtcgaacAAGACGTGGATCATTCTCGGCGCGTGTTTGGGAGCAGTCGTGCTGCTGT
TACTCATCGGTCTCAtctggtggtgctgtcgccGACGGAGAAATGAGCAGCCTAAACTCACGAACAGCACGATGCCATCGATCGCCATTGGCATGGGCGA
CCTGTCAGACCATCCGTACATGGAGCTAGGTGTGCCCCGTTCCAATGCTTCCAGTCAGACGACGTCGGACTTCGAGTTGCTCGCGTCTGTGGCAGACGGC
TACATCGGGCTGACTCGGTTGTCCTACGACGATGTCTTCCTGCACAAGATGCTACGTGTTAGCAGCCGTTCCGAGCTGTGGTTGGGCGAGTACAAGCATG
AGCCTGTGCTCGTGAAAAAGATCAAGAGTAACACGGCATCGaaagcgctgctgcgggacTTTGTAACGGAGATCGAGCTTATgttcgagctcaagcaccc
TCGCATCGCTGCCTTCCGAGGCGCAATGTGGGACGCCGATGGCACTGAACTCTGCGCTGTGGTCGAGTACGTTGAGAAGGGCGCACTGAGAGACTGCACG
GTGAACAACGCTATCGAGTTGTCCGTGCcgaagcagcacgccatTGCTCGGCAGATTTCGGAGGCGATGGCGTTCCTGCACAAACAAAATATCGTACACG
GTCGGCTGAATGCGTTCAACATCCTGCTGGATAAGGACTACTCTGCCAAGCTAAGCCTCTTCAGCATCTTCCACTACGTCAAACTTTCACCTCTGGACAA
CGAGTGCAAAATCTTCGTGGCTCCAGAAATTCTGCGCGGAGAGCAGCCATCGGGAAGGTCAGACGTTTACGCATTTGGCGTGGTGCTCGTTGAGATCGAT
ACAGGCGAGACCCCTGTGATGAACGCTCGGAAGCTGTCGATGGAGCGCTCTGGTCGCGAAGACGTTCTCTCCCCGACTGCGAAAAGGACCGGATTCCGCT
TGAGTCGGCTCTGTTCGGGCGTGATGAAGGAAACCATTGCTGCATGTCTGGAGAAGGATCCCGCACGACGACCATCGATGGCAGAAGTGGCGTTGGCTTT
CAAGAACGGCGCGATGAAGTTGTAA