Transcript Name :
Phyra_g7888
Orientation:
(-)
Number of Exons:
14
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site7.803PS50096
HECT66.922PS50237
HECT69.929PS50237
HmmSmart predictionP-Valprediction_id
HECT0SM00119
HECT0SM00119
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-858
859-881
882-1271
1272-1294
1295-1897
*** None ***
PositionContextScore
294MRGRHAR|VQ0.517
1414RRARSRR|EW0.747
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
ubiquitin-protein transferase activityGO:0004842IEA
*** None ***
*** None ***
Sequence
        10181 bases(100 bases per row)
TGCTGACTTGTGCCGTTGCAGTCGCCGAGCTCAAGAGCCTCTCGGCCGCGTGCAACAAGCTCTGGGAGCTGGACACCAACCGTCTGGAGCCCAACGTGCA
CTACGAAGTGAACCTACAGGAGGGCAAGACCTCCTACGCCCGCGGTGACGCGGCGCGCGAGCCGCTCTTCACGTTCGTGGACCCGAGCGTTTTCGAGCGC
CGCACGTACAAGCTGCTCTTCGACCTGCTGGACAACTACGAGCGCGAGGTGCGACCAGTTTGGAGAGTGCAATGAACAGAGTGGAGTCGTGACTGGAGTT
ATGTGGTAATTGGCTCCTTGTGATACACAGACAGGTGTGACGGAGCGCGTGACGCCCAAGGAGTTGGCGGAGAACAACGCGTTCCTGAACGCTGTGCTTG
AGACGGCGCCCATGCGCTATGCCCACGCGTGAGTATGGCGGTGATGGCGGTGAGGGTGTAGATGTAGTTCTGACTGTATGCGGTCAATTGCAGTTGGCTG
GTCAAGAACAAGAAGTTCACGGGCGACATGGGGGACTTCAAGAAAAGCTCGAGCTCATTTGGTTCGGGCTGTACCGCCGTGAAGTGCGCAACGACTCGTC
GGGCTTTGAGCACGTGTTCGTTGGCGAGGAGAAGAATGTGAGATTGATGATTTATCTGATCAGTGGATTTAGTCTTGTTGCTAATGGATTTGTTCGCCGA
GCAGGGCAAAGTGTGCGGTTGCCACAATTGGCTCCAGGTGTACAACGAGGAGCGCAACGGCCGCATCGACTACAGGGGATACATTCGCCCTAAGCAGCGC
GGATGCAAGTTTATGGAGCCCCACAACAAGGAGCAATTGATCACGTTCCAGTTCCAGTGGGAAGACGAGATAAAGCCCGTGTCCACGAGGTGAAACTTGG
CTACTGCAATCAAGGTTTCTACATTCAACGTGACTAACAACGACTATGTGGTGGCATTTTGCAGCTTGATCGGAGTGAGCCCGGAGTTCGAGATGGCCCT
GTACACCATGTGTTACCTGAACGGCCAGGAGAACAACAACGTACAGCTCGGCCCGTACCTGTGCAACATCAAGTGCTTCAGCTTCGGCCGGGGCAAGGAC
ACGAAGATCGGCACGGCCTTCCCGGAGGCTCTACCGTTGACAGATGCGCAGGCAGCTACCAAGATCCAGGCCATCATGCGTGGTCGCCACGCACGCGTTC
AAAACCCGCAAGTCCGTCGCCAGGCGCCGCCTCCTCCCCTGGCGCTGCGTGGGGCCCGCCGCCCGGTGGTGTTCCCACTCCGGCCCCACAGTCTTCCCAG
TCGACTGGAAACGCGTGGGCTAAGCCACTTACCCAGCCCGCTGCCCCCTCGGCACCTAGTGCTGCTGCACCTGCGGGCCCGAAGGTGACCGGTGCGTGGG
CCCAGCAGCACAAGTGGTAGCTTTGCCACAACTGAAAGAGCGTCAGCCAATTGCACATACTAGTCAGACTGCGCACTGCAGCTTAGCTTCACCGTGTAGA
TAATCATCCGTACATGCGACAACAAAACTTTGCATTCGTTTCGAGCCATGCTCCGAGTTGACATGCAGCAAGTGCGTCCCATTTTAGAGACCACGATAGT
TTCGCAACCGAAGATCTTGGCGTCCCTCCATTCTCGCTCAGTTAGGGAACCAGCGAAGGCCGCAACGATGGAGGCCAAGGACACGCCGACCGAACCCAGG
CCATGCACAAGCCTTTGTCCAAGGCGCAGGCCGACGAAGCCGATATCAACGCGGACGACTCGGGAGCCCCGACCCCGGAGATTGTGGCACTGCGTGACGG
ATACAACCAGACGTACATCGTCCGGTCCAGCAAGAACAACCTTCATGAAGTTCTCTTCCGTTGTGGCAATTGGTGCTACAGCGGGAAGGTCGATCTCGGT
AGTGCCGACCTGGAGCTCGCCGATCTGCCGGTGGTCGTACCTGCCCTACAGAAGCAGCAAGCTTCGCTACAATATATTTGCGAGTGGAAGGCCATGCCCT
CAACGTCTCAATACTCGACACCTCTTGAAACGCTGTACGATGTCTACGACTTCATCGGCGCTGAGCTTTCAAGCGAGCGTATTGAACGCAAGCTGATGAA
AGCTGCAGAGGAGCACACGTGGGTGGACGGCGATTTGGACGATGGTGGATCGAGGACCTTTTTCGAGTTGCAGAGCGGTGGCTATGAATGCTTCGATGAT
GTGGACATCGTGGCCAGCAAGACCTTTGTGCGTGGGTTGGTGCTCTTGGTAATCTACTACCAACGTAGTTTCTACGTCGTGCTGCAGGAAGCAGACGGCG
AGCAGCCTCTGCTCGATGTGCGTTTCCCGGACCTCTCGGCTCACCTTCAGGGCATCCACTTGCAGACATACCGTGAGGACGACTGCAGCAACATGAAAAA
GCTCACGCTGTGGCAGGCGGCTAGTATCGGAAAACACAAAAGCCCACCGAAGCCACTGAAAGTGCAATGCAAAGATGTCAGTGGCACAGGTTACAACCAG
ACCTTCCTCATTCGGCGCACCCCTCGTGCTGAAGGCTCCACAAACACCCCGAGTTTGCGCGAGGTGCTCTTCCGATTTGGCAACTGGTGCTACAACGGGC
ACGTGGATCTGGGACCAAAGCTTGAGTTGTCAGACATTCCTATCATCATCCCCATGCTTCGACGACAGCAAAGTGCTCTGGTAATGTTCGAGTGGTCAAG
TTTCATTCTGCTCGCGGTGTTACTCATCGTGTGTCAATTTTGCTTTTCGTAGACCTTTATGTGCGAAGTCTCCAAGATGCCAGCGACATCATTATTTACC
CCGTCGATGGAACACTTGGCAGGAATTGTGCCTGCCATGCAGGAAGAGATGTCCAAGGCAGAGCAATTCGTGCAAACACTGGCTCAAACTGGGGGGTCGT
TCGTCAAGAGCCCGGGCAACGTTGGAAGCTGGCTTGAGGATGATAATGTTGAGTGCTTCTTTGAAATTGCCATGGGCAAATGCGCTGCATTCCAGGTCAG
TTCACTTTGGTAGTGTCATGCTTCATTAACTGCACGACTCACTCAACGTTGCTGGGCTTGATCTGCATAGGATGTGGAGGCTATTGCGAGCAAGATCCAC
ATTGGAGGCGTCGTGCTTGTGCTGCTATACTATGACTACACTTTCTACGTCTACCTTGAAAATGGCGAGGAAGAGCAGCCGCTACTTGACACAATTTCCC
AGACGTCTCTCTTCAGAAGGAAGGTATCCAGCTCAAGACGTATCGCAATGGAGTGCGTGGCTGTGAAAGAGCTACGCCGCATCAGTCTGTGGAAGGTCGA
CAACGATTTTGTTGACGAAGACGAGGAGGAAGATGCCGCAGCAGTCGACTGTATCACATCACGCACCAAAGATCAACTCCGAGCCGATTCCAAGGAGGAA
CACCGACGCGAGGAAGGTGTGAAATCGTCGCAGACGCAGACGCAAAGGTGGCGAGAGAGAATGCAACCACGCAAGTCAGCACTGCCACATCACGTCGCTC
CGTTGAAGCGGCCTAGTGGAGCCGCGACTACCAATCTCAAAAACATGCTGATCTTGGCATGAAGGCACCATGGGACGACACTGGCAAGCCACTCGGAATG
CGAACGAGTAAGTAAGTCGGACGGCTAAAATGCTACATTAAAGCCGTCTCGCTTACGAAGCCATGGTGCCATACATGCTGACGAAGGTTTGTTAATCACT
TCATAGCTCAACAATTTCGGCAATAGGAAACACTAACCATTCAAATCCCGCACGTACTCCGTCACTGGCACATACTCGCTGCAAAAGTCACTTTCGACTT
AGAATCCCTCTTCAGCGACAGTGAGCCAGTCAGGGATACTGGTGCCGTTGGAGCTGCTGTATTCTTGCGATGAAATAGTCGAGAGCCGAGCGCTCTCCGT
GGCAGCATATACTGATCCGCCAACCCAGGCAAGCATGTTCCGCGGGAAGTATGTCTGAACGAGCTGCGCTCGTCAACAGCAGCCGAAGCCGAGCAAACTC
ATTATCATGATGTAGAGCCTCGCGTACTTCATCCATGACACGCTGCGCCAAGCCTGAAGCATAGACAGGTTAGCATGGCTGCAAAGGAATATACCAACAT
TTTACCCGAACGGTAATTTTACCAGGAATCATAGCGGTTCCTCCGACAAGCAGCAGGTTCTCCAGCATTGCTGCTCTCACGTCGAGCGGGGCCTTCTTCA
AGACTTGGATGATGCCGTCGACAATTGAAATCCCATCCGTGCTTTCGTCACCTGAACAATCGAATTGCGAGGTGAATCGATGTGTTAGGAATTGCAGCAG
GCCATCCGATACCACGAATGCATACCAATCAGTAGCTGCTCTACGGCTCCAGTGCGCAAGTTCCAGGAACCTATTACGCAAGTAGGGTCCAAGTGAGACA
CCGTCAGAAATCTGCAACGAGTGAAAATGAAGCCTTTACTACTGCGACCGACCTGCAGCACATCATTGTCGTGGGTCTGAAACTCTGCGTCAACCACATT
TGGCAACGGATTCTGATCCACGAAGCACATAACAGCAGAAACATGAGCTCCGCGATATATAACTTCGGCAATATGAAGTCTCTCCTGGTGTACCTTTTGC
TGTGCGAAGCACGCCCGTTCAAGAATGCCTTCTGCAATGGCTTCAGTCACAGGCGTGACAACGGTCTTCAAGCTATCCATCGGCTGGTCGCGAGACGTAT
TCAGCTCTCGCTGAATCAACTCACAGCAGTTCCGGCTTCCAGCAGGCACAGCTTCAACACAGCAACACCACGTCGCGTCACTTCCACATTCTTCCACAGC
TTCTAGTAACCAAACTTACTCTCGTAAAGATAAGGGAGCGGTATACCCTTGAACACAGGCAGCAGTCGCGTCTCTGCCCAGCCGCAGTCTACCACCAAAG
CTGTGTGGTTTGCTGTACCGTACAACACCGCCATCATGGACGGCACCAACGACACCGCAGAAGCCTGGCACAACCACAATACCCTCCTGTTCAGCCCCCC
AAACCACAACTCTCTATTCATCCAATAACCACCTTGAGAACATCAAATAAAATGCTCAAGAGCGTCTCCCGGAATACCCGCGGCAGCAGCAGATCTTCAC
ACACGACGAATCGGCGACGCGTCGGATTCACCAACAGCAAGCTGACAGTACAGCAGCCTGTTAGCTACGCAACCCACGCAGTCGATGCAGATCCAAACCA
CTCACTCGAAGCACAGCGTGTGCAGCTCCGGATACAGATACTGGCGCCAGTCCGCGGCGGTCAAGGGCTTCTGCAGCATGTCCCCCACCTGACCACATAC
TCCTTGAGCAACCTCGAACCCGATGCGCGCAATACGGTGACAACGCACCTGCCAGCGCACGATACAGCGAGGCGCGCGCTCCCCAGAGATGCCGCATCGC
GCGTAACGTGCCCCCAGCTCCAGCACCAGCGCGCTCTTGTCGTTCAGTGCGCCGCTCATGATATAGTTGTATGCACCACTTCAGTGACTCTATCGATGTT
GAGTTCCCCTCGAATTAATGACTATCATCGACATCAATGATTGTGCTCAATTTGAAGAAGGCGAAAAGCTCCGAAGATGGCGGACGTGATCGTGGTGCTC
ATCGTGGCCTCCCAGGTGGCACTATACCTTATCGTCGCCTACATCTTCCGCAAACTGCAGCGCAAGTACCGCGAGCGCAGCTACAGCGAGTTGCAGCAGG
CATTGATCGCCAGGTAGGCGGCGGATTCCTCGTTGTTGTTGTTTTTTTATTTTTTATATTTTGAGGTGTTGACGCTGTGATAATGTGGCTTCTGCAGAGA
TGATGCGACCGGAGAGCATCGCATTGATGTTGCAACGTTGTACGTAGGATATGGGGGGCTGACGGAGGTCGGTTGGGGTGTTGAGGACACGCTGCTGACT
GAGACGGGGTGGCGGTTGCTTGCAGGGACGCAGAGGAGGAGGCAGTACGATGCATAGTGTGTGCATTCGCAAACACACAGAGGTTCAGGTTCTGCGTGCT
TTGCGGGGAGAAGCTCAAGCTGTCACCGACAGAGAGATCTCGGGCAAGAAGCCCTCTTACCGCTCGACAAGTGCGGGCAAAGTGCGTTGTTGGTTGGTCT
TTTGTTGTGTATGCTTTGATCCGCAGGCTGACTTCTTATTTTATTATATGGTGATGTGTGCTAGGCGTCGAACAGAATGGCAACGCAAGCTTGACTGCAC
CGGAAAGGCCTGTTGGTATCGGAATGCGGAGGCGTCTCAAAACTGCTCCCAGTATCCTGGATATGTTGCTGTGTTCAAGGAAGGGGGTGGCAAAGATGGC
AGAGAGATGGAGACTGAGGTGGACGTGATACCGGACGGAGAGCCTGGTTCAGTAACTAGGAAGCTGGAACACGAAACGAAGCTGATGAAAATACAGACTG
TGGCTGCCGACGAAGCCGACGCACTAGCATTCGCGACGGGGCCACCTTCGTCCAGAAATGTCGACGTCAAGGGCCTGCTCAATTTGTCAAGAGAAGACTT
CCCAACCAAGTTCGCACATTTTGTGGCCTGTACTTCTACGCTGATTGTCCCACCTCAACTGGAAGTGCTGAAGCTGTTTCTTCGTCGTGAACACGTTGTC
GAGGAGTCCATGGAGTACTTGTGCTGTATGGATGACAATGATACCCATTCGGTGGTGCGAATTGATTTTGCTGCAGAGACTGCTGTAGATGCTGGGGGGT
GCACCGCGAATGGTTCGCGCTCGTGACGGAGCTGGTTATTGACCCGTCTCTGGGGGTTTTCACCTGCACGAACCATGCGGCCCAGACGTATTTCTTCAAC
GTAAATTCGAGGCAGGCGATCGGTGAGGAGCATCTAGCGTACTTTTTCGCAGTTGGACGTCTTGTTGGCCGTGCGCTATTAGAGGGCGAAGTGGTGGGCT
TCCACTTTGCACCAGCGCTATTGAAGCTCATTCTCGGTATTCCGTTCACTTTTCGCGACTACGGGGATTTGGATCCGGTGACGTACAAAAGTCTTCTGTG
GATGTTGGAACACGATGGTGCCGCGACGCTCGGACTAGATTTCACGACAACGCGCAGAGATGCAAGTGGAACCATGGTGACGGTGGATTTGGTGTCAAAC
GGTGGCGAGATCCCGGTGACCGATGAAAACAAGCACGAATTCGCAGAATGGTGGCTCCACTACCATTTTCTAGAAAGCGTTTCAAGCCAGCTGTACGTGT
TTTTGAAAGGCTTGTACCAAGTGATTCCGCGGCAGATCCTCATGCTCTTTGACGTGGAAGAGTTCGACTATGTGCTATGCGGTTGCGACTCCATCGACGT
TACGGACTGGGAGGCACACACGAGGTGCTCCAAGAACTTGACGGGGACGCGAGTGCTTCGGTGGTTCTGGGAGCTGGTGCGGGACATGAACCTGGAGTGC
CGGCGTCGCCTGCTGCAGTTTGCAACGGGGTGCTCGCGAGTCCCGATCGGTGGCTTCCGACACCTGACGAGCCACGACGGTCAGATCTGCCCGTTCACGT
TGAAGGGCGTGCACTCCCCTTACATTCGAAGCCACGCATGCTTCAACCGGTTGGACGTGCCGTTGGCATCATCGCGAGCGGAGCTCAAGGAGGTGCTACA
CGCTACGCTCAACACCGAGACGTACGGGTTCACGACGGCGTAGGAAGTCGGCAGCGTGGAGTATCCAAAGACCTAAATATCGACTGCAAATTATGAGCGG
CGTGTCTTGCCGTCATCGTGGAGGACAGTGGAGATGCATTGTCACAACGGCCTGTTTTCCTCACGGAATGCAAGTGCAGGTCGCCTGCAGATGTCCGACC
ATTGACCAAGAGGCCAATGACCGATTGCACGCGTCGGATCGCCGATCCAGACGTCACAAGTGCTGGCAGGAACAACGGCAGCCAGTGACTTGACCGCATG
GTTTGAAGCAGAGCCATCGGGTGCGCACCAACGTTGGTACATTGCCGTTAGGGGAAACCGGTGACGGAACATGCAAGCCCCGTCAACATGTCGCTGTGAG
TGGATTGTCACTATTTCGAGGGGATTCGTCGCCGTAATCTAGTGTGCATAAACGCGACTTAGCAATACTGAAACCAAGTGAAAAATACGGATCCCTCAGC
GAAGGTCATTCTGCGTGTGACTGACTTGAACCGCAGCACTTGAAGACTCGCCGCGATGGACAACGAGCGGTCCACGGAGGCGTCGATGCTGTACCAGGGC
GTGGGCATGCTGCTGCTGTGCATCATCTTCTTCGTGGTGTGGCTCATGGCGTGTCGTCGCAACCGCCACCTGCTGGACATGGAGGTGCCGCTGCTGTCGG
GCGAGTCGGTCGACCACCGAATCGACGCTGCCACGCGAGAAGCCGAGGCGGGCTACAGCGTGTGCGCCAGCTGCGCGTTCGAGAACTTCAAGCGCTTCGA
GTACTGCGTGCTGTGCGGCGACAAGCTGCCGTCGCTGTCCTTCGCCACGGCCGACGACGAGAGCGACGACGAGCAGCTCAAGCCGGAGGACACTTGCAGC
AGCAGAGGAGGAGCCATCAACATGGCCATGAGCGCGACCCACCTGCTGTCGCCACGTCCGAGGAAAATGTCGTCGCTGAGTCGCCAGCAGCGGCGTGCGC
GCAGCCGACGAGAGTGGACGAGGAAATTGGACGTGGAAGGGAATCTCTTCTGGTACCGCAGTGGAGGCGGAGGCCACGTGCCTGCGAACAGCGACGTGGA
CACACTCTTGCCGGGGTATACACTGAGTTTCAAGCTCCCGGAGGAAGTGGAACAGCAGGAACTGGCCGAAGAGCAAGAGCAGGAGAGGAAAGAGCAGGAG
GAACAGGAAACCATGACGGAGACGGAGCCAGTGCCGAGTCTGGCTGTGGAGCAACCGCAGAGTGAGAAGGAAAATGCAGACGACAAGCCCATGCTGCCGA
CGGACGTGGAGCTGGAGCTGGTGGAGGCGAGCGTCTCGGACCCGGCTGACTTCGCGACCGGGAAGTCGACGCTCGCCGATGCTGGGCTGAGCGACGCAAG
GAGGTTGTTTCTTTGGCGACTAGCGACTTTCCTTCAAAGTACGCGCACTTTGTGGTCAGCACGGCCTCGCTGATCGTGCCTGCAGAAGTGGAGTTTTTGA
AGTTGTCTGTCCACCGCGAGTACATGCTGGAAGAGTCGATGGACCACATGTACTGCATTCAGCCGAAGAACTTGCGCTCCTTCATGCGCATCAATTTCCT
GGATGAAAGCGGCGTGGATGCTGGCGGGGTGCACCGCGAATGGTTTATGCTGGTGAACGAGCTGCTGGCTTCGCCGACGCTTCGACTCTTTACATGCACC
AACAAGGCCGACCAGAGCTACTTTCTCAATCCGCAATCCCGGTCTGAGGTAGGCGAGGACCACCTAGCTTACTATTTTGCCACAGGTCGACTGATTGGTC
GGGCTCTGCTGGAAGGCGGCATCTGGGGCTTTCATCTCGCACTGCCGTTGCTGAAGGTGATCTTGGGTATGCCAGTGACGTTTGCCGACATGGAGTATCT
CGACCCAGAGGCGTACCGCAGTCTCCGATGGCTGATGGACAACGACGGCGTGGACGACCTCGGACTTGACTTTAGTCTAACCGAGCAGGTAAACGAAACC
GAGAAAATCGTGGTGGATCTTATCCCCAATGGACGGGATATTGCTGTCACGGATGCCAACAAGCGCGAGTACCTGGACCGGCGTTTCCGCTACGTGCTCT
TCGAGAGTGTGGCGGACCAACTGCATGCATTCCTGAAGGGTCTGTACGAGGTTATTCCTCGCGAGATGCTTTTGATTTTTGACCCAGAAGAATTCGACTA
CTTGCTGTGTGGATCCCCGAAGTGGACGTAACGGACTGGGAGACTCACACCGTATTGTCTCCTAACCTTGAGGGCGTCAGCGTAACTCGCTGGTTCTGGG
AGATTGTTCGCCAAATGCCGAACGAGTACCGTCGACGCCTGCTGCTGTTCGCGACAGGATCTGCCTGTGTCCCTCTGTCGGGTTTCCGGGGTCTTACCAG
CTACGATGGTCGCCTGTGCCCGTTCAACCTCAAGGGTGTGCCCTACCGCTCGACGCAGTACATCTCGAGTCACGCATGCTTCAATCGTCTGGATCTGCCG
CTGTACCACAGCAAGAAGGAGTTGAAGAGTATGCTGTACGCGACGCTGGACACGGACCTCACGGGCTTCACGACGGCATAA