Transcript Name :
Phyra_g10069
Orientation:
(+)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Sec7 domain34.347PS50190
HmmSmart predictionP-Valprediction_id
Sec7 domain0SM00222
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-655
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        5578 bases(100 bases per row)
ATGGCGGCGGCGCGCTCCGAGCTGCTGAGCGACATTCAGAGCGTGCTGAGTCTCGCGCGGCGGCGACATGGCTTTCTGCTGTCTGGGACGTTAGACCAGC
GCTCAAAACAGGTGCGATAGCAAGCGTCTTCTCCTCGAAAACCTCTATTCAAAAAGGTGAAAAGGCGCTAATATTTGCATTATTATGGCAACAGGAGGGC
CCCCTGGCCGTTTTCCAGAGCTTCTCGGTGCTACGCGGACGTCTGCTGCGATGCGAGAGTGCGTGCAATTTCTTTTACGCCTCTATACGCTGCGAAATGC
GTTGTTTTAACGCTTTTTCCGCCCCTTTTCACGCAGATATGGATGAATTGTCGCCCGTGAACGTCATCAAGCCGTTCCTGGACGTGATCCGCCACGAACA
TGCCAGCAGCACCGTTACAGGTGCCGCTTTGCAAGCCGTAATGAACCTGCTGCGCTCGTGGCCGTGGGCCGACGTCAAGGACCAGAACGCGGCGGCGGAC
GCCGTGTCGGACGTCGTCGACGCCGTCAGCCACTGCAGGTTCCAGGAGACGGCCATCGAGAGCGACCAGAACGTGCTGGTGCTGGTCGTGCACGTGCTGC
ACGCTGTGGTGCGCTCGCCCTGCGGTGCCAGACTCTCGGACCACTCCATGTGGCAGCTGGTGGAGTCGCTCTACGCGCTCAGTCGCGGCAATCGACATGA
TGTACGTGCTGCTGCTGGTCAATCTGGATCGGGTTGGTGTTGACGACTCACTGTTGTGTGTTTACAGCCTCATATTACGCTGCCGTTGCGATCTACAGCT
ACAAACTTTCTGCATGAACAGTGGCCTTCATCTTTTCTAACGCTGCTATCTATTCAGACTTGGCACCCGCTGCTAAGCCTCTTAGACCAGGATTCGGGCT
GCCGTGTGCGGTGAAGATCGTGGGCTTTCTCTGCCAGAAGCTGCACCAGAGAAACTTCCTGCCCCCTCCTGCCCCAGACGCACCCGTGGGGACTACTGGA
AACACGACAAGCCGGCGTGAAGTTTTGTTGTCCTTCAGTCTTCTCCAACGCGCGCTGATCGCGTGTGATGCCGAGCTGATTACGAAAGTTCCGTCGCTGA
TGCTTTTCATCAAGGACGATCTGTGTAGCGCCATTTTGCGCTACTGCCGTCTAGGGTAGGAACAATGTTGCTTTATGCTCCGCCATTTTTTGTTGATCTA
ACTTTCCCAATCCGTGAAATGGTATGAGCAGTGCCTGCGCGGAGCTCAAGGTTACAGTGGTGTGTCTCGAGCTTATCCGGTTGCTCTGGTCGAAGCTCCG
CTCAGACCTGAAGATGCAGGTGAGGCAATCTTCAATGGCGTGTTCTGCCAGACGCTTCACTGGAGTCTTGCGAACATGGATGTGAACAACCCAGATTTCC
CGCGTGGAGATAACGTGACCCCGCCGGCTGCAGGTGCTAACGGCCAAACAGACGACAAGACTGTTACAGTTGTTGAAGCAGCTCTCGATGAGTTCTCCGG
AGATATGCTGTCCAAAAGCCGATTGTACAATATCTCGTTTGAAATTATGGATTGTTTGGTGGATTTGCTGGCGGAGGCTACGCTGCTGCCCGACTTGTAC
GTAAACTACGACTGCGACGGCAACCGCTGCGACTTGACGCAGAATTTATTCGAGCTCCTTTCTCAGGTAGCACAACAGTCTCATGTTGCATGCTTTGAAT
CACACGAAGAAACACATTTCCTGTGGGCCCAGGCTATTGGAGAAATCGCTCTTCGCGGAATGTTCAATGCACTGTACGTCGTTCATCTCCGTACGCACCC
AGAGCCCCACCACTGAGTGGTGACAGCAGTGGTCCAAGTGACGAGGAGAATAACGAAGATGCGCTGCTTGTGGATCAGGACGAGCAGCTAGTACCTGCTG
CTGATGGCGACAGCTTTGCCTCTGCTGACGTATTGTTTAAGAAACGACAGCGCAAGAAGTTTTTCCAGCATGGCATCCAAGAGTTCAACCGTAAACCATT
GGCTGGAATCAAATATTTGCAGCAAAACACGTTCCTGCCTACACCACTCGACAGTATGTCGCTTGCAACGTTCCTGCGATCCCTTCCGCAGGGCCTCAAC
AAGAATGCCGTGGGCATGTACTTGGGTGCGATGGGCAAGGAGGTCAAAGGGTTTGAGAAAACCGAGATCCATGAGGCCGACACGATGGATTTCCACCGCG
ACGTCCTGACCAACTTCGTTAGATCATTTAACTTTGAGGGTGAGAGTATTGTTACCGCGCTGCGGATGTTTCTCGCGAGCTTCCGCCTTCCTGGAGAGGC
GCAGCAAATCGACCGCATCCTGAACACTTTCTCACTCCAAGTGTACGAACAGTGTCGTGAACGGTTTCTCATGGCATCCGTAGATGTAGCGTATCTGCTG
TCGTTCAGTCTGATTATGCTGAATACGGATCTGCACAACCCGAATATCCGATCCGACAAGAAAATGAAGCTGATCGACTTCATCAAGAACAACAAAAACT
ATGGCCAGGAGGTTTCCAAGGGCCAAGATTTGCCTGAAGACTTCCTGACTGAGTTGTACAATACCATTGCGAAGGACGAGATTAAGACATTTGAAGACGG
CGGTAAGCACGGCGAAGTGACAAGTGATCGATGGAAGGATTTACTCAACCAGGCAGAAAGCAACCCTCGTAACTCGCGCTTGATCGTACATCACCCGTCG
CTGCACCTCCGATCATCTAGCACTCCTCGCGGCGTTGGCGTCACGCAAAATGTGTCGTCGCCTCTAGCTCCTGATGTCATGCGAACGATGAAACAAGCTC
GGCTTACCAAGAGCGCTTCCAGTCCCGCTAATGGGTCTGCTGGTCTGTCCAAGAGGGGAACGTGGGAGCAGCAGGATGGATTCGATGGACTGGTACCCCT
TTATGGCTCTTCAGGCAACCAGTATGATCGCCATATCTTCGAGTTGCTTCAGCAAAGCCTCGTACGAGCTTTTGGCAGTGTGTTCCAGCAGTTTGTCGTT
GATTCACAGGCGAAGGACGCTGCACGAGGCGAGGACCTCTCTGTTGGCAGCAGCTATGAGATGCACTATGTACCGCAGAAAAGTGCGCTCCAGCTTGCAT
GCAACGGTTTCGTATTGTGCACGGCAGTGGCATCTCATTTGTCGCTGGTGGAGCACTGCAACGCACTGTTTATCCGCCTTTGCAAATACACGGCGCTGCT
CTCGTCGGATATTTATCCCGTGGGATACAATGGTCGCGAAAACGGCATCTGGGTGTATTGCGACAACCAAAGTGCTCCCGTCGCGACAGCTGCTGTGCTG
AAGCTCGTCAACACATGCAGTTTGTCCCTGCACAGTCGCTCGTGGAAGCATTTCTTCCATGTCATGGGTGGTTTACGTGAATTTCATGTTCTGCCATCGC
GTATTTTGTATCCGAGCGATGAAATGAACCTGGAGCTAATGACGTCCGACGAGCGTCTAGAGTTTATTGACCTGGTGTACCAGAACAAGGAAGAACTGGA
ACGGACGATCGCGCTTAGCGCCCAAGATCAGGATGGTGGAAATGGCGATACTGGTGGCTTCTTTAGTGGTGTTGCGTGGCTACTATCAGCCCTCGACTCG
AATCTCGGCGGCTCGGCACCGGACTCATCGACACCAGCGAAGTCGCATCTTTCCCCTGGTTTTGAGCAGTATCAGCTAAGCCCAGCAGAGTTAGCCTCGC
ACACGGAAGACCTTGTGATCGAGGGAACGACTCCAAACAAGCAGCCATCCGATGGCGAGAATGACTCGAGAGGAGAGTTTGGAACGGATCGGTGGATTCG
AACCACATTGCAGCCTTACCGCCTTGAATTTTTGATGCAAGATGTCGCAAGCTTGCCATCACGCGCCTTAGCTGAGGTCATTGAGGCGCTGCACGACGAG
ATTTTGCAGGTGCTACAAGGCCCTGACGAGGAGGCGTCTCGAAAAGACCGAAAGAAGTCTACGAAGCTGTCCCTAAGCCAGGGGGGATGTGTGCTGTTTG
AGCACTTACTGAGCCAGGTCATTTCACTGAGCGGCTCCCTCTTCGATGGCGGTCCAGACGATGAAGACGGAATATCTGCTGTGCTGGAAGCGCATTATAC
CCAAATGTTGGAGTTCGTACGTCCAGTTTTGCTCACTAATCAAAGCCCGAGCGGGCTGACGTACGAGAACGCGTGCTTCCTATTGCAAAAGTCAATCAAT
GGCTTGTTTGCTTGGGTGACGCGTACGCGCAGTGATGCGAACGGGTTGCTGCTCGTAAATTTCCTGAGTACTTTGATGGAGTTGAGCGGTGATGACGAGC
TCATCCGACCGTTCCTGACGCCAATCATGTGCGGGTTGGATCGATACGTTACTTTGGTGGAACCAAGCAACTTGCGCTACACACGCGTGGACTGGTTGAC
GATCTGCAATTTGATCAGTTGGTCTGTTGGAATGCCGCATGCAGCCTCGCACGCTTTTGGGCTTCTTGAGCGCCTCGTGACGAGAAGATCTGGAATGGAG
ACGGGAACGAAATTCTTATCAGCGATTGCTACACGAAGATGATCATGTTCGCCATGAAAGCCCGCGACCCACATGATACCTGGGCTCCATCGCGTCCAAT
CGATCTGCTCCTTTTCATGTTTGACACACTTCGACCTGACGCGCCCAACTATGTGGAGGAACGCTTGCGCTTCTTGGGTGGGATGACTGTTGTATCGAGG
CACTTGCTGCTCAATCAGATTAAGCAGGAGCTTTCCAACGATCTCGTCGTCGCGGCAATCGAAGGATTGAAGCACATGCTACGTGAGCACACAGGAACGG
AGCAATCGTTTAAACCTGTAGCTTGGCTGGACGTGCTTCGGTACGGACTTGTACCTGTCGGCTTCGACCTGCTAAACGGTGCTGACCAAAGCATTCGGGT
GGGGGTTGCATTTCGGAGACGACGAAGAGGAAACAAACTCACCGTTCCTGTATTACCGGAGACAGCTGCCTTCCATTGACGACGAGGGCTCTTTTCAGCA
CCCAAATGATGTGTACGCGCGCAGCGATTCTAAGGGGTCAACTGGCCGTCGCCGACGACCATCAACTATGAAAGACCCGCTAGCTCTGAGACCGCACGTG
GTCGTGGTTCAGCTACTATCGCATGTGGTGTGCGAAGAGTTGACAAAGCTGCAGACATGCACCAAGTTTCCTACCGTGTGGGAAGACGTGGCAGAGCTGC
TAGTTGGGTTGCTCGATCACACCGCCATGGAAAGTCCTTCGTCCGCGGCGGATGGAGCTGCGAGTGGGGAAGTGCTTATTGCAGCGCTGGAGCGTCGTAG
CGTTCTGTCGGCTCATGAGGAAATACTCGAGCACAGCAAGGGATTATGAGGCGCTTAACAGTGCTGCAGGATGAGGAAACAAAACAGGAGGAAGGTACCC
ACGACGCTGAAGGAGTTGTTCAGAAGCCGAACGTTTTGATGAGTGCACTGGAAGAGAAGTGCCGTTCACACCCCGACATTTATGAGCAGCTCTTCGCCTC
GAAGGACGATACGGGATCTACTGGCGGACTCACGCCACCAATCGAAGAAGTGGACGGCGAGGCCCCGAAGAGCAGATG