Transcript Name :
Phyra_g3541
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein L914_18588
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-362
363-385
386-403
NN-scoreoddsWeighted Score
0.6142.0930.004
*** None ***
TypeScore
cytoplasmic30.4
GO
*** None ***
*** None ***
*** None ***
Sequence
        1335 bases(100 bases per row)
TGGAGAATTATTTCCCGCCAAAGAATCAGGACGGGCGACTCGAGGCCACGGCCATCATTGGCAATGCAGACGCGAGTAAGGAGACTCTTGTTGGTATTTT
TGTGGAGAGATCCTTATTGTTGTGATTTGATGCGGGTGCAGACCCAGACTATCACATGGAGGTGACGGACCCGGAGAAGGAGACAAACCCATCCATTGAG
ATCATCTCGGGCGTGTGGGAGGACTCGCTCTCGGCTGCGAACATGGACCTGCTAAACCGACGAGGATATTTGAGCTACCCACTGGATGACAAGCTGCACG
TGGTCACATTGAACACAGTGCCCTACTCGGTAGGTTTCTGCAAGTTTGGAGATTGGGCTGGGACTGATGGGTTTTGTTGCTGTGCAGCCGAGTCATTTGC
CGGACACTTCGGACCAGCCAGACCCGTTTGGACAGTTTGAGTGGCTAGATACGACCCTTGCTGAGCTGCAGGACGCTGGGAAGTTTGCATACATTGCTGG
CCACATCGCTCCGATTGTGGACTCGTACGGAGGCAACCCGCAGTGGCACGTCAAGTACATCGCGGCGTACAAGAAAATCGTTGGCAAGTATGCCGACGTA
ATCAAGGCGCAGTTTTTCGGCCATGTCCACAGTATCGAGTTCCGCGTGCCTGTGGGGTCACTCGACGGTGAGGATGATGCTTTCCAGCTGCTGCCTATGT
ATATTACGGGCTCCATCTCGCCGCTCTTCGGCAACAACCCGTCCTTCATGGTCTGGGACTACGACACCGAGACGTACGACGTGCTCGACTACGCTGTGTA
TGCCTCTTCTATCGCCGAGAGCGACCCGCAGCTTGACTGGAAGCTTCTGTTCCGAGCGAGTGAGGCCTACGGCCTCAAGTCACTATCTAAGTCCGAGCTC
GCGGCCTTTGTGCAGCGCGTTGAGCAGAACGCGACCTTGGTGGAAGATTACTACTGGAATATGAAGGCCCATTCGCCCAATGCTCGACCCTGCAAAGACG
CAGTCTGCCACGCGAAAACGCTGTGCACGCTCAAATGGTGGACGACACAGGGCGAGTTCCTGGCCTGTGTAGACACTATCCAAACGATGGCTGCCGCTCG
CGTGGATAGCAACGATCCGACCTCCGAGTCACCGGCTGACGTGGACTCAGCGACTTCGTCCGGGTCCAGCTCCTCGCTCTACGATCTGGCAGCGACAGAT
GTGTACATAACAATCGGAGCGACTGCACTAGCAACTGTCGTCGCCATCACGTGCGTTGCTGTGGCCGTCTACATCCTACGGCGCGCTGGCATCCTTAAAA
GCCGCACGCAGTACGATCCCGTGGCTACGCTCTAG