Transcript Name :
Phyra_g3343
Orientation:
(+)
Number of Exons:
1
Description :
polx_tobac ame: full=retrovirus-related pol polyprotein from transposon tnt 1-94 includes: ame: full=protease includes: ame: full=reverse transcriptase includes: ame: full=endonuclease
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-135
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        407 bases(100 bases per row)
ATGTCCTCTGCCCACGACGCCTCCACCAAGGTCTCCATCGACAAGTTCAACGGAGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGTTCCTGA
CCAAGTCGGTGTGGCATGTCGTGAACCGAGAGACGACGCCGAGCTTCACGGACTCGCGGCCCAAGGACGAGTACGTCAAGTCGAGCAACATCGCGTTCGG
ACTGATGTTGCTCCACATGGACGCGGACTACCACCATGTGGTCGACGACTGCGAGGAAGCGTGGGTTGCGTGGACGCGCCTGAAGACGCTGTACGGTGGT
TCGCAGAAGGCTGGTCGCATCTACCTGAAGCGCCAACTCTTCAGCATGGAGATGTCGGAAGGCGGGAATGTGACGAAGTCGATGAAACTTTCTCGCCCAA
GTGTATA