Transcript Name :
Phyra_g9336
Orientation:
(+)
Number of Exons:
8
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Leucine-rich repeat5.094PS51450
Leucine-rich repeat9.029PS51450
Leucine-rich repeat8.112PS51450
HmmSmart predictionP-Valprediction_id
Phosphoglucose isomerase (PGI)0.42SM00365
Phosphoglucose isomerase (PGI)43SM00365
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-518
519-541
542-552
553-575
576-579
580-602
603-622
623-645
646-671
672-694
695-742
743-760
761-769
770-792
793-803
804-826
827-830
831-853
854-1147
1148-1170
1171-1179
1180-1202
1203-1208
1209-1231
1232-1259
1260-1282
1283-1302
1303-1325
1326-1348
1349-1371
1372-1391
1392-1414
1415-1418
1419-1441
1442-1453
1454-1473
1474-1482
1483-1505
1506-1665
1666-1688
1689-2159
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        12476 bases(100 bases per row)
ATGCCTCGCATTACGGTGGAGCTTCTGCGCAAGAGGGCAGAGCACAATGAAGGCATTATCTCCAGCCTCGAGGAGATTTCGCTGCACCAAGAGGAGCTGG
AGAAGGTCGAGGTGATCGGTACTTTGTGTCGCAAGCTGCGGATTCTGTACCTGCAAAACAACATCATCGAAAAGATAGAGGACTTGACGCACATGAAGGA
GCTGCGGTACCTCAACTTGGCGCTCAACAACGTCAGCAAGATCGAGGGCTTGCACAGCTGCGAGTTCCTCAATAAGCTGGACCTCACTGTCAACTTCGTG
GACTTTGACACTCTGGAAGACAGCGTCGACCATCTCAAGTCTCTACACCACCTCCGAGAGCTCTACATGCTCGGCAATCCCTGCCAGTCCGACTGGGAAA
CGGGCTTCAGGCAGTACGTCATCGCCTCGCTGCCTCAGCTGGAGATCTTGGATGGCAAAGAAATCCAGCGCAGCGACCGGATCAAGGCACTCCAGGTGTT
TCGAGAGAGGCAGCAGTACGTTCGGAGAGAAGCCAAGAAGGTTTTAGCCAAGAAGGAGCTCGATCGAGAGAGCCCTGCAACAGATGAAGCGGTGATTGAA
GTGGTGGGCGGACAAGCGACTGACATTTCAGAGGCTCAGGCAGCAGAGAAGGTGGGGAAGAAGTCTGTGATGGCGTCGACGGAGAAGGTGCCATATACGC
CGCACACTCGTCGCGAGATGTACCTGGAGATGGCGGAGCAGAAGGAGGAAGAAGAGGCTCGGCGACGCGAAAACCAACCGAAAGAACGGAACACCGAGGT
TGAGCACGAGGAGACACTGCGGAAGGCTCGAATGAAAGAAGAGCGGGCGGACGGGTCCATTCGGCAGTGCAATGAAGGCAAGTGGGAGTTCCGTCTGACT
GACGAAATTCTCGACATTGTTTTGGAAGTAGATCTGCCTCGATTCCTTGACACGTCGCTCGTGGATGTGGATGTTCATCCTTCGTACGTCTCCATCGTGG
CCAAGAACAAGGTTCTGCGTCTCAAGTTCCCTGAACTGGTTCATTCGGACGCTGGGAAAGCTGAGAGATCGAAGATCACAGGCACTCTTCGCTTGACGCT
GCCAAAAGCCCACGTTACCCCGACGCAACAGCTACGTGCGCAACTTTATCGCGAAGAGCAAGAGAAGGACAAAACTGCAAAGAAGAAGCCGTGTACGAAG
ACAAAGACCACTACACGGCCCTCGAAGATCTCGGACGAGGTAAGACGGATCTATTTGCTTACGACTTATCTACAGCATTCATGTTATTTTTCTACGAATG
CCTCCAGCTGCTTCAAGCTGTAAACCATCTTTTGCCAGGCCAACGACATGGCGGCGCTGTCAATATCCGCGGCCTGGTCAAGAAAGACGATGGCGACGAC
AATAATGCTTCTCATGGGCGGTTGCAGATGACACCGCTAGTTACCAAACATCTGCGAATCACGCGATAGCAGCAGGCCCAGAAGTTGAGTTGGAGGCGGA
CGAAGACGCTCCCCCGCTTATTTTCTAAATGAAAACCTGCACGTTTCCTTGACTGAAAAAACATGGCCACGAATGCCTCAGTATGGATGCTGCTTTATTT
TTGCATGCCGTCTCAAGCGAGTTAAACGGACTTCAAATAGTTCAACGGCTTGGAAAAGTCCAACCAACAACTGCCAGTTGAGAATTTGCCGGAGACACCA
CTGCGTAGTCAACATCAAAGCCATGAACAGATCGGACCACTGTAACTCACGTGGGAAGTCGAAGCACCCCTATCACCGCAGTCGCTGGCCTCGCAGAACT
ATGCGTGTCTGGGCGGAATCACACCGCTGTTGGTGCACCAACTCACAGACACAGAGTCGGTAGGGTGGGTGACCGAAATGACCTTCATCAGAGCCGACAC
GCCGAGTCAGTTGCGTCAACGGTTTATCCAGATCCAAGTCGTCGATCAGAGGTTCAAGGAGCCATCCTGGATGCATCCCAACATTGGCGGCGAGGCTCAG
TATGTTCAAGGGCGAGCTGACGAGATCGCAGCTATTCACGAAGAGCTCGACGCACACGAGAAAGAAAACAAACTGGGAGAGTGGACAGCCACATCTATCG
GTGGCAATGACATTATGTCCAGTGTGTTATTCTCCACGGGGCAAACCATCGCAAAAGCCGGGAAATTGGCACCCGTGACCCAGTTGCTCGTCGCTATTGT
GATTTACTGTCTTCGCTGGGTGTTCGAAGAGGTCATGAGTGCTGTGCCACTGAATGGAGGCTGCTACACTGCGATATTGAACTCGGGGCCGAAGAAAGTG
GCGGCCATCGCTGCAGTTTTCAGCATTTTGTCGTATCTGGCAACGGGAGTGGTGAATGGAGTATCGGCCATGAACTACGTGAACGAGTCTCTGTTTGAGC
TGCCCGTGATGATCTGCTCCATTGGACTGTTGGCCATGTTCGCGCTTCTGTGTCTAATGGGCATCGCGGAGAGTGCTTTCGTGGCACTGATCCTCTTTTT
GTTCCACATGTTCACGCTCACCCTGCTAGCAATTTTTAGCATTGTGTACATCGTGCAGCACCCCTCTGTCTTCATGGACAACATGAACACATCGCTCCCT
GATGTGACGATGTTTGGGAATGCTGTACAAGGTGGTACTGTCTGCTCGGCCCTGTTTCTAGGCTACGGAACCGCAATGTTGAGTGTGACGGGGTTCGAGA
GCTCTTCGCAGTACGTGGAGGAACAAGCCGCCGGTATGTTCCCGAAAACCCTGCGCAACATGTGGGTCTTGTCCAGCACTTTCAACGTCATGTACTCATT
GCTGGCGCTGGCAGTTGTGCCGCTTGACACGATCATCTCGAACCAGTCGACGCTGCTGTCGTACATGGGAAGGTTGAGTGGCGGTCGGTGGCTGGAGATT
CTCGTAGCAATCGACGCGTTTGGCGTGTTGGCTGGCGCGGTTTTGACGGCCTATGTTGGAATTGTTTATTCCAGCGGTTGGCCATTGACCGTGTACTTCC
TGGCTTCTTGCTCAAACAGAACTCGTGTCGTGGAACGAACCACTTTATTATTTTAGCCTTCTTCATCGTGTCTGCGAGCCTCGTGTTGATCTTGGATGCT
GAAGTGACGGTGTTGTCTGGTGTCTTCGCGCTCGCTTTCTTGTGCGTGCTGCTGTCGTTCACGAGTGCCTGTTTGTTACTCAAGATTTATCGCGAGGAAA
TCCCGCGCAAAAGAACAACATCGTGGACCAACGCTTGCTTCTGCCTGGGTATGATCACGTTGGGAATTCTTGCGAATGCGTTCTCCGATATCAAGGCGCT
GTCGTATTTCTTCATCTACTTCGCCGTCTTCTTCCTGGTCGTGTTCCTGATGCTGACCCGCGTGAGTCTGCTCAAGGGATTACTCTACATTTCGCGCAAG
CTGTTGCTGCACTTCCGAGGTCACAGTGAGTCAGTATCCATGCAGCAGCTCTCGGTTCAGGGCCAGGCTTTTGTCGGCAGTGTGAAGATTGCCAAGACGA
TCGAGACGATCAAGAACACGCCTGTGGTCTTCTTCTGCAAGGTGGCCAACTTGCCCAAGATCAACGAGGCGGTGCGGTACGTGATGCAGAACGAGCACAC
GTACTGCCTGCGACTCGTTCACGTGTGCGAGCCGGATGCGCCTGTGCCGCGTGAGTTTGAAGACGTGGTGAACTTGTTTGACCACATTTACCCGTCGATC
AAGATCGATTTCATCGCCGTGACGGGAGCGTTTGACCCGGCGATGGTGCAGTGGCTGTCGAGATCGATGGCTGCCCTACGAACATGATGTTCATGCGTCA
ACCCGCTAACGAGAACATCCACCGCGTGTCGGCGCTTGGCGTTCGTGTCATCACTGAATAATGAGTGCATGCTGGACCAGAATTGGCGAATCCTACGAAA
AACACAACAAGAGAAAAATTTGCAGTAGGTGATTCTATCCCGTGGCTGGCAGACACTGAATTATTTTACTGAGACCACCAGCAAGTCTTGATTTATGCTA
TTGCGCTCCTTCCTCGACATCTTCGCGTCGGCGGAACATATTAAGCGAAATTGGATATAGAAAACCTTCACAGCGAAAGTCGAAACTAACTTGATGAGCT
TCGGAATATGCTTCCATAAGCACAGTCATCGCGGCATAGATTGCGTGCATGGTACACAAGCAATCTTCACGAGCGGCTGCCGAAACTGCACCCACGACTG
GGAACAACGAAGACCTGCATGCACGTTTGCAGAACGGATGCAGGCTCGCCAAATAGCGGCAAAAAATATTCGCGTCAAGTCGGCAAACTGACCACGCAGA
CGGTGGCGGAGAGTAGAGGTCTCTCTCCTGTTTACAACTGCTCATCATCGATCTGAAGTGCGTCCACTTGACACTCGGGCGATCACCACAGGCTGTGGTC
CACAGCAATCCATCGCCCACCAACGCCGTGAGCAGAGGCGACAGTCCCATCCTCTCCCGCCGCAGAATCTCTTTCGTGCCCACGACGTTTTGCAACGAGG
ACAAGAATAATCTACCAAATGTGCACTCTCAAGCATTGTTTTGAAGACCATATCTTGGGCTCGTTCCTTCCTGCATGTATTATGTATTATATCAAACAGC
AGCGTTTCGGATATCTTACCCGAACCTTCCAGTTCACTTGCCAAGTTGGCAGCCCCTGATTCCTGTTGCCGCGTTTATTGCCGAATAACGATGGCTTCAA
ACGCGCAATGGCCAGCCAAGACTGTGCCGCCTACCCACCAAAACGTAGTCTGGACAAAGTAAACAAGCGACGCGTCTCTCCCTTCAGTTTTCAGCTGGAC
GACATACGATCCTCAGTTGGCAATTTGCTCTGAGGTGTTCAAGTGCCTCATTCCGTAGTGAAAGTCATGCCCACGTCCAGCAGAGAGCTCCGTCTGGACT
TGCTGTCTCCGCAGTCGCCAGCGGGAGACTACGCGCCCCTGAGCGGCATCTCGTCGCTGGCCGTGCACCCGCCCCCAGACTTGGACTGGGTGAGCGAGAT
GAACTTCCTGCGCGCCGAGACGCCGAGCCAACTGCGCCAGCGGTTCATCCAGATCCAAGTCACGGACCGGCGGTTCAAGGAGCCGTCCTGGATGCACCCC
AACATCGGGGGCGAGGCGCAGTTCGTGCAGGGTAGCACAGACGAGATCCACGCCATTCGAGAGGAGCTCGAGACCAACGACAAGAAGGACAAGCTGGGAG
AGTGGACGGCCACGTCCATCAGCGGCAACGCCATCCTGTCCAGCGTCTTGTTCTCAGCGGGCCAAACCATCGCCAAGGCGGGAAAGTTGGCGCCCGTCAC
GCAGCTGTTCGTGGTGACGGTGGTCTACTGCCTTCGCTGGGTGCTGGAGGAGGTCATGAGCGCTGTCCCGTTGAACGGAGGCTTCTACACGGCCATGCTC
AACTCGGCGCCCAAGAAAGTTGCGGCCATTTGTGCCGTGTTTAGTATGCTCTCGTACTTGTCGACGGCGGTGGTGAACGGCGTCTCGGCCATGAACTACG
TGAACGAGTCCCTGGTGGAGATCCCCGTGACGGTCTGCTCCATCGCGTTGCTCGTGGTCTTTGCGCTGCTGTGTCTCATGGGCATCGCTGAGAGCGCGTT
CGTGGCGCTCGTCATCTTTGTCTTCCACACCTTCACGCTCACCCTGTTGGCCATCTTTAGTCTCGTTTACGTGGCGCAGCACCCCTCCATCTTCGCCGAC
AACATGGACACGTCGCTCCCGGACGTGACGATCCTCGGCGGCGCTGCAGACGCCAGCAACGTCGCGTCGGCTCTGTTCCTGGGTTACGGCACGGCGATGC
TGGGGGTGACGGGGTTCGAGAGCTCTTCGCAGTACGTGGAGGAACAAGCCGCCGGTATGTTCCCGAAAACCCTGCGCAACATGTGGGTCTTGTCCAGCAC
TTTCAACGTCATGTACTCATTTCTGGCGCTGGCAGTTGTGCCGCTTGACACGATCATCTCGAACCAGTCGACGCTGCTGTCGTACATGGGAAGGTTGAGT
GGCGGTCGGTGGCTGGAGATTCTCGTAGCAATCGACGCGTTTGGCGTGTTGGCTGGCGCGGTTTTGACGGCGTACGTTGGCATTAATGGGCTCTTCCAGC
GCCTGGCAATCGATAGAGTGCTACCCAGCTTCCTACTCAAGGTGAATTCGTGCCGCGGCACGAACCACTTTATCATCTTGGTGTTCTGCGTCGTGGCTTC
GAGTCTCGTATTCATCTTGGATGCCGAAGTGACGGTGTTGTCTGGTGTCTTCGCGCTCGCGTTCCTCTGCGTGCTGCTGTCGTTCACGATTGCTTGTCTG
CTACTGAAGATCGGCCGTGAAGAAATCCCGCGCAAAAGAACAACGTCGTGGTTCAACACTTGCTTCTGCCTGGGTATGATCACGTTGGGAATTCTTGCGA
ATGCGTTCTCCGATATCAAGGCGCTGTCGTATTTCTTCATCTACTTCGCCGTCTTCTTCCTGGTCGTGTTCCTGATGCTGACCCGCGTGAGTCTGCTCAA
GGGATTACTCTACATTTCGCGCAAGCTGTTGCTGCACTTCCGAGGTCACAGTGAGTCAGTATCCATGCAGCAGCTCTCGGTTCAGGGCCAGGCTTTTGTC
GGCAGTGTGAAGATTGCCAAGACGATCGAGACGATCAAGAACACGCCTGTGGTCTTCTTCTGCAAGGTGGCCAACTTGCCCAAGATCAACGAGGCGGTGC
GGTACGTGATGCAGAACGAGCACACGTACTGCCTGCGACTCGTTCACGTGTGCGAGCCGAAGGCGCCTGTGCCGCGTGAGTTTGAGCACGTGGTGAACTT
GTTTGACCACATTTACCCGTCGATCAAGATCGATTTCATCGCCGTGACGGGAGCGTTTGACCCGGCGATGGTGCAGTGGCTGTCGAAATCGATGGCTGTT
CCTACGAACATGATGTTCATGCGTCAACCCGCTAACGAGAACATCCACCGCGTGTCGGCGCTTGGCGTGCGTGTCATTACGGATTAGACGTTCACGAGTC
TACTTCGGCTAGCGAGTGGACTTGCTAAGTTAAAGAGAGAGCTCGAGTTTGCTGTTTCGTGTCAAGGATGATCGCACCGCTTTCCGGTATCCGGATACTG
TACCTACATGTTCACGTACATGTACACGGATGGTTTGGAAATTGACTTTCGGTTCGCAGTGGTAGACTGCCGCAATGATTGCCAGTTTGCGACAGGTACT
GGTACAAAAGCTCACGTGTGATAGGCAGGCACTCTGCAATCATGGGATGTGACTCCGATTAGCATGTCCGACTGCCAGTCGGCGACTGGGGAGTTGGTCA
TTGTCCATTTCTCCAGTTCAGACTGAGAGCGCAGTCGCCGCCGCGTCACTCTGCAGCGGCATGTCGTCGCCTCTTTTCATCTTGGCAGTGTTCCTCGCAA
TAACTGCAGCAGCTGAGCACCGCAACACGCTGCACAACTTGCAGAATGAGACGATGACAGAATGGCCATCATTGCGCTTCCATTTCACCATCAAGCGCGA
CGCCATGCAAGTTCACGGCCACTCCGAGTTCTCTGTGCTGGCTAACCCTGTTGTGTCCACCAATGGCGATAACAGTGACAGCGTGCTGTACGACACCTTT
GCTACGTTCGAGGAGGACTCGATGATGCACACCTACACACTCGTAGACGGTATCGCGTACGTCTCCGAGAGCTCTGTGGACGATATCAGCGTTGACCCTT
TGGTGAAATGCGTGGAGTCAGGAGTTCTGATTCCAATCAACTCGATCGTGTTGGCACTCAACGAGGCTGTTCCTGTCTCGAGTATCTCATCGAAAAGTAG
CGGAACCATCGAGTGTTCCAGTGGGAACACGTTCAAAGCCACAGTAAACGGTTTTGATCTCGGATTGTGTTTCTCGGATTCTTCCGGATTCACGATGTAT
GGCAACGATATGAATATCGCCGTGGAGTATTTGGAGAGTCGTGAAGACATTGCCGCGCCAACGATCAAGAGTGACGTGAAGAATGAGTGCGAAAAAGTGG
CGTCGGCTAGCTCAGTGACATCGATCGGGAGGTCATTTCTGACTGGGGCATCGATTTCTCTCGAGGATACGAGAGAACTGCGAGCTGCGTTCGATTTCGA
TTTCTCGATTGGTGATGATGATACGTGCTCGTGCAAGTCTACGCCACGCCCATGCATCTTTATCCACGGGTTAGGAATCCTCCAAGAGGCGCCGGAAAAC
CTGGACACGTTCCCTACCAAGTATTGGGGCAACTCGACCGTGACTGCTCATGCTCCATGCTGCTCGTCAATTAAATTTGCGCTGCTGAATACGATGAATA
ACTCCTGGACGGACGATGCCCAGCAGCAGAAAGTGTGCGATCGAGTTCTTGCGGTTAGCGAAACCAGTCAAGGAACTGCAATTTCAGACACCATCATCAT
CACGCACTCCATGGGCAATCTCATACTGGCTGGTGCAATTGCTTCAGGCAAGTGCAGCCTTGACTCTAACGTGTCGTGGGTGGGCTTATCAGCGCCAATG
CGGGGGTATGGCCTCCAACTACTTCCAGGATTCCTGCAAGAACGAGACGAACGCATATGTCGAAAAATTAGTGGCGAAGACCGGCTATTGCCCCGCAGAC
GACGGTATCATCTCTCTTGCGTACGAGGGAGACGAATACAGCTCTACCGAACTAGATGCAGCGTATGCGGCTGCGCAGCAGGTTTATCGGCGACACGTGA
CAGCCGTAATGTGCAGCGACGGGTTTTCCGGCCTGCGGTCAGATCGGCAATGGTGGTATTGGTGCTAGGCATCGTCATCCCCAATAAATCCTTCGACAGC
GATGGCATGGTGGAGCTCGATAGCTCGCCGGTGGATTCTCCCATTTAATGTTTGGAGACACCTACAAGGATCGATTCTACGTGACAAAACTCAACCACGC
AGACACAGCGTTCCGGAATGGCGACGCACTCTTCAATAAGGCAAAAATGCCTGTGAAGTGGTTCGAGTGTCTTCTGTAGTTGACAGCTAAAGGATAAAGC
AACAAGAAGATAAAATTATTATGAAGCTCGCGGATTTTCGTTGGGTTTTGCTTTGGGAGGGGGGGGGGAGGAAAACATCTTCACATGTCAAGTCGTGATC
TGGATATGCTCGACCGACGATTCAAGTGGCACAAAGGTTGAACGTAGCGCGCCAACAAAGCTGAAGATAAGCGGTTGACCAGCAAAAAATTCGAGTTGAG
CTCACTGTCAATTTCAACACGAGGCCTTCTCTCCCGGATGGGACGTCACCAATTCACTAATGCGTAAGTTCTGTAGAACTTAATCATGCTACGAGGAGCG
TAAGTCTCTAGTTTGGTGCTCTATGACACCTTCGTCCGTTCACTGAAGGCACAACAGTGTACGATTACACGGTGGTGGACAACGCGTCCTGCATGGACGA
CAGTTCTGGGGATGTGCGGAGTCAGATGTCTTGGTTTTGATCGATGCTATCGTGTCGGCACTGAGCGAGGCTGTATCTGTGTCAAGTACCTCTACCAGCA
GCGGAAGTTGATCAAGTGCTCCAGCGGTATTCTTCCAACGCTACGGTGCTTCGGGTTGTGCTTCTCAGACTCGTCGGGTTTAACTCCCCCCCCATTCACG
ATGTCAGAGGGTACGACAAGTCTGAAATCAGAGGCGACTGCTCAACGGATGTCACGTCACGCGACCTGCATGACGAGACTGAGCACCGTCCAAGTTTGCT
TCAAGACAAGACGTAGCAGAAAAGTTTACTAGTGTCGTCGTGTGCCTATCTGGAGGTGGGGAGGGTTGCATGGTGATAACCGGCTCAGGATTAGCCCTTT
CGGATCTGTAGGCTACGTACCTATAGGAAGAAGTAAATGGCGAAGCAGTGGCAACGTCTTATTCAGTTATACCAATCGGGCATTTACTGCTGACTGGTGG
GTTGTTACCGACGAGGCACGAGAACGCTAAAACCCGCGCTTGATTTCTCGTTGAATGAGGCGTCTGCAAGTCAACACCGTGAACTTGCATCTTTATTAAC
GGCTAAGGAATCAGGACACGGGGACTCCAGAAAACCAACACTCTTTACTAAGTATTGGTTGATCACAGTGAATCATGCCTGGACGGAGGATGCCCAGCAG
CAGAAAGTTTGCGTTGCAGCGAGCAAGACTCCATGCAGTCAAAAATCAATGATTTCTGACACCATCATTGTCACTCACTCCATGGGAGCTCTGGTGCTGG
GTGGCGCAATCGCTTCAGGAAAGTGCCATCTTTGCTGTAAACATAACAAGAGAGGGCATGGACTCTGGATCAGAGCGGTCTCTTGTGTACGAAAATGAGG
AATACAGTTCTGTAAACCTCATTTTCGTAAGCAAGAGACCGCGGACGCATGTGGCAGGGGTGATGTGCAGACCGGGCTCATTTCGGCAGTTCTGGCTGCT
GGGTGTGGTTCGCAAGAATCCAGCCAAACGACGGCATGGTCGAGCTCCACAACTGCGCTGCCGGGATCCCGACATGCGTGTCAAACTCAACCACCTCGGC
GTGGCCCTCCAGAGTGGTGACGCACTCCTGATGCGAAGATGCCAGTGCCATGGTTCGAGTGTTTTTTTTGTAGGTAAGCGTAGGTATCGATCATTTCCCA
GCCTGATACATTTCACCCGAAAGCAGACTCGCTGAACGGCGGCATAATATCGATGCCGTGTCAAAGCCCATGATAAACCACCTGATGCCACCGAACCGAA
TACCAAGCCCCTGGAATTCCTATGTCCCAAGCATCCTCAATGTCAGTTGAGTGGCTGGTTGGGCACAACTCTTGACGGCGTCAATGATCAACCGCAGATC
ATCCGTCACCCTTACACTGTTCGAATTGCCTCCTAACTGTCGATTGCCTATTCATAAAAACACCATCACCATGTCGTCTCCTCTGCTGCCTTCGCTTGTA
GTCATGTTTGCAGCCTTCCTCGCATTCGCAGCTGGCCAGAGCAACTTAGTGCAGGATGGCACGACAGCCGGATGGCCGTCCCTGCAGTTCCGCTTCACGA
TCAAGCGCAGCGCCATGGAAGTTCATGGTGAGTCCGACTTCTCCGTGCTGGCCAACCCTATCATGTCTTCGCTCAGTGATCCCAGTGACAACGCCAGTGT
GCTCTACGACACCTTCACTGCGTTTGCGGAAGATGACATCCTCTACAACTACTCGCTCGTGGACGGCGTTGCATACGTTTCTCGTGGCTTTTTGAATGGC
AGCAGTGTCAACAACCCCCGGTGAAGTGCATGGGTGCGAATATTCTGCCCCCAGTGAACTCGATCGTGGCAGCGCTCAGCGACGCGAAGCCCATTTCGAC
TATTTTGACGAGCAATGGCAGTACGATCCCATGCTCGAGTGGCAATTCTTTCAAGACTTCGGTGAATGGCATCGATTTTGGACTGTGCTTTTCGGGCTCG
GCAGGATTCACGATGTATGGTAGCGACATGGATATCACGGTGGAGTACGTCACGAAGCACATGCATATTCAGGCTCCGACCCTGAGCGAGGATGTGAAAA
ATACGTGTGAGAAAGTGTCATCACCCAGCTCCGTGACATCGATCGGAACGTCCTTGCTCACCGGAGAATCCATTCCCTCCAGCGCTACGAGGGAGCTGGA
AGCTGCGTTTGAATTTTCTCTAGAGGAGTCGTGTTCATGCCAGTCGATGCCGCGCCCGTGCATCTTCATCCATGGTCTCGGAGTTATTACCGAGGAGAAG
GAGAATCTCGACTCACACGCATACTGGGGCAATTTGACGGGCCACACGCCATGCTGCTCGTCGACGAAGTACGCGATGCTGAACACGGTGAACAACTCCT
GGACCGACGACATCCAGCAGCAGAAAGTTTGCGATCACGTGCTGGAAGCGAGCGATACCAGCGAGGGAACCACTATTTCTGACACCATTATCATCACGCA
CTCTATGGGCGGCCTCATGTTGGCAGGAGCGATCGCGAATGAAAGGTGCAGCCTGGCTTCGAGCGCGACATGGGTCAGCACCGGAGCACCAATGACAGGA
AGCATGGCATCGAACTACTTTCAGGAATCCTGCAAGGACGAGACCAATCGGTTCATGGAGAAATTTGTCGAAACGACTGGCTATTGCCCCGCAGACGATG
GAATCAAGTCTCTGGCTTATCAACGCGAGAGCTACAGTACAGCAGCACTGGATAGGGCATACACGGCTGCACAGAAGGCATATCGACAAAATGTGGATGC
CGTGATGTGCAGCGATGCGTATTCAGGAATTCTTTCGTCGTACCAGGTAGGCTTCTGGGTGCTGGGCAGTGTGGTCTCTCACAAATCGAAAAAAAATGAC
GGCATGGTGGAGTTCCACAGTTGCGGCGGCGGGTTTCCTGCATCCAAATTCGGCAATGATTACCACGATCGCTTCTATCGAGCGAAGCTCAACCACTATG
ATGTGGCGTTTAAGGCCGGTGATGCACTTCTCGATAAGACGAAGATGCCGGTGAAGTGGTTTGAGTGCCTGCTGTA