Transcript Name :
Phyra_g9653
Orientation:
(-)
Number of Exons:
9
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-668
*** None ***
PositionContextScore
13SWKRFAR|EL0.586
TypeScore
cytoplasmic52.2
GO
*** None ***
*** None ***
*** None ***
Sequence
        10614 bases(100 bases per row)
TGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTG
TGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTC
AAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGA
TTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAA
TGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAG
CTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGA
GAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAG
GGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTC
ACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCT
GAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAAT
GAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCC
CGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGAT
CTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGT
GATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAA
AGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAAT
GGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGAT
TATGCGGTGCAAGAGGCCGACGTACACCCTCGTCGTCCTTGTGGACGACGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTAC
TTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCG
CAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCC
TGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAG
CGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTC
CGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACA
GACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAA
GAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACA
CCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACAC
GTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAGTGGGGGAGGATATCCGGTTAATTCAAAACAAC
CGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGACGGGCGT
AGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTT
GTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACACCGGCAGGGGAAACA
CAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCTTGCTTGCTCCGCGCTT
CATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTG
AAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCAAGGCGCCAGAGAGCCTCGTCCCGAC
CTCGACCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTCAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGA
CGCTCAACAGCCTCAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCCCCCCCCCCACCCGTTGCGAGACGCACGCGGGGCAACTCGC
TGGATCGTCCAGCGAATTGTTGGTCATCGGAACCAGGACCGGCCGGTTCATTTTCATTCGTTGGAGAGGATTTCCTCCCCAACACGATATGTAATGGGTC
TGCTTAGACCCACTACTTAAGCTTACACGTGTGCACACGTGTATGAGGAAGCGTAGGAATAATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTATAC
TTAAACCTAAATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAATGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTATAATGAGA
GGTTCTGCCATCGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAA
TGTGGACCACCCTGTGGAGTGGTCACCTGAATGTATTCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGGACCGACTGTGTAGCCCGCTACACATAGACA
CACCAGCCGTGCGACCGCCGAGTGTGGGTGTACTTCGATCAAATCCACTACTGGTGTCAATATTTGGCTCAGCCCTCGTACAATATCCCTCTGTTGCGTT
ACTGTAATCGTAGCAGGGGCCTCAGTGACAGCCGTGTGTATGTCCAATGTAATATTTTTCCTTTGCCGGATGTACGCCACCACTGGGTGATCTGAAGGTG
AGGCCGTGAAGTGGACCTCTCGGTCATATGTGGTTCGTTCTGCCAGTTCCGAAAAATTGTATACAAGTAGCCGCACCATCTCTTCTGCGGAGTTCTGCTG
TTGTTCCCCCAAGGGTGTCCGTAAGAACATAAAGTCAATCCATCCATACGCTACTCGCTGCCACTGGACCACTTCCCTAGGTTGCAGGCCTGTTTGGGAA
ATCTTCATGCTCTGGCTAATGACCTGCGATGTCCTGTACCTGTATACACCTGAAGTTGCTGACATTCAGCGCACTGTAGCCAGTCTAGCTGTGGTAGGCC
TCTTTTTCATTTTTTGGCCTAGTGGTAGACTTAGCAATTGTCCTTAGAAACTCCGTGCAGTCAAGACTGAGTGAGCCTCCCGTCCATGAGGTGTACAGTT
CTCCTTCCTCAGAAGCCAGCATCACAAACTTTTCCATTCCCTCGCCCCTTGTGGATCCGCGGTACCAGCCTGTATTAGTAGCGTGCGTCCAGTTTTCCAC
AATGTCGTGCGTCTCTGGAAACCAGCTGCACTGGCGGGTGCAAATTTCCAGTAATATATATACTCTTGGAGCTAGTCCGGCCGCGTTGTTGTAAAAAAGT
ATATCTCCAACTACGTGTGTGTTGTGCGTTCCCCATTCAGCCCAGTTTCGCACCGTGACTGCCGCTTGTTGTTGGCTTTTGCTGAAAAGGTGAAGAACCG
GACGGAGGATGTCGCTGTCCTTTGCTCTGAGAAATTGGTATTGGGGGCTGTACCGTAATTGTTGACTTGAGGTGTGCTGGAGCAACTGCGTAGCGGGTAG
CGATCAGAGGTCGGGGTCAGACTTGAAACTCCAGACGAATCTCCCAACGCGTGACCTAGGCTACGAACGGGAATCTAGAGTTGAACAGGCCTTTATAAAT
CTACCACGGCTGATGCTGCCACGCATGGGCGAATACGCCCTGGTGAACGCGACATCCGGTCTTGAGACCGGAGCTCTTCCATTGACTTCGATCGCAAGCT
TGGAAAGGATGAAAGGATCCACATATTTGTTTACTTGGGTTCTGTGTGGAGGTTAGCTGGAGCCTTCGTGTATATATCATAGCTTGCGTGCTCAATAGGA
ACTCATGTATTAACTCCGCATTCGCAAAGAAGATTTGCATTTGAGCTTTGAAGAATTACAACTTAAACTTCACCTTCGTGGCTGCGAGCATGACGAGAGC
TTCTGAAGCTATTTGAGGTGTCGTATCTCAAGCTGGCGAAACTTGACGCTCATGCAGTTTCGCGGGCGATACAGCTGGTAAGTTGAATGGAAATACCTTA
GAAAATTCGGCTCAATCAAGTTTTACTAGTCTCTACAGCAATGATTTTAGTGTACACAGCCTCAGTGATTCGCAGCGAAAAGTGGCACATGGACCCCGTA
CCGAGCTTAACTATTCGATGCATACCTGTCAGGAGCAGAGGGAAGAGAATTTCAAAGCGAAGCGGCTTGCAGTATAAGCCGTCGTACGCGTTCACGGACC
ACTAGAGCCGACTGACTGGCGAGCGAGAAGTGATCGGGCACCCAATGCTGAAGACCCTTCAGGCGTGTTCGTGGCCAGGCATGGATCTGACTGCCATGGC
TGCAAATGGAGAAGGTGATGAAGCGGCGGAATCAAGCTTTGGAAACTGTGTGGTGGATTCTGGATCAAGCGCTTCCGCCGCCAGACGTGAACTTCAAGAC
TTACCAATAGACAGTGTGCGACTTGATGCAACCAGTCAATCACAGAAGGAGCTACGCCTGATCCTGGTGCATCAAGGTCAGCGTGCTTCCTTGGCGATGG
CAGAGCCAGACATCTGGCCTGACCAAACTTTCATGGATCTTGTAGAACAGGCCGCCAGTGATCCAAGTGGAATCGCGGGTTGCCTTACATGTTCCCTTTC
ATGCTGCCATCAGCATGAAGGTTCATACTTTCATTGAGAAGGATGGATGGTGACGACTGTCCAAATCTCTCACTCTTCAATTTGCTAGTTACATCACAAG
CTACCAATACACTAGGCTACAAGTTCCAGCAGGATCGCCACCTGTCGCCCGTGTTTGAGTTGCTTCAACCTCCGGAAAACAGCACAAAGAATTCTTTAGT
GGTACTGACGTACTACTCGCTCAAGTGGTACGACCGACCTACTAGCCGACGTGACCTGTCGTCATGCCGAAACGCCACGCTGATGATTCAAGTGACGAGG
AGGAGTCCTCCGAATACTCGAAGCCGATGCCTGTACCCATCTTCGCGCCGATTCTCCCACCAAGATGAGTTCCATTTCTCACAAGCGTGGTGAAGTGGGA
TAAGCTGCGCATGGAGTATGAGGCCAAGATGAGAGCTCGTTGCAGAAGCTCTGGCGAGGACTATAACTTGGTGACGCAGAACGTAAAGGAATCTTTCGAT
CTCCGTCTCCTAGAGACGTTCTGTGCGCTGAGACTTCGGAGGACGTCGCCGATGTCACCGAAGGACAACTCATCGCCGAGATCAAGCATCTACTAGGGAA
GGTCAAGAACGACCTGCCCGACATCAAGACCCTGTGCGCGAAGGAACTACGGATGGATCTGTCGGAGACAGACGTAGATGCCCGCGTACTGGCCTATTTC
AGTGTTTCCATGAAGTCGTCCTGGAGAACGGACTTGAAGAAGTTTTCTCCGGTGATTATGGTGAGAAGGATACGTGCAAGCGTTTGGTGTCGTGTTTGGC
CCCTCCGGTCCTGAAGGCCGATGTCAAAAGTGCCGTTCGCTGGACTAACAAGGAGGCTGGCAAAAACATTCAAAAGCGGTACACGCTGATCTACGAGAAG
GCTGTCGAACACGAGCGTCATTTCCAGCAAACAAGCGATGCGACTGATGGTGAAGGACAAATTCGCTCCCAAGTCTGCGAAGAACGTTGAGAAGTCGACT
ACGGCTCATTCGAAGAAGCGCCTCGTAACGATCTGGTAAGCGATCTGTCGAAGAATCCGACACGACGGTTGAGAAGATGATCGACCAGAAGATTACAAGA
CCTTTAACCGTCTATCTCGCCAAGAGCCGCCGTCGCCGTGCCCGAAGTGCCAAGATATGCACTGGCTCAGCGATTGCACGAAGGCAACTGACGCTGAGAA
GATTGTGCTTCGGCAGAAGCTTCGCGAAGCTAACAAAGCTCGCCAGTCTCGCGTGAAGAGATTGAAGAAGTTATGCCGCCGACCTCACGCACTGTGACAT
CAACGGCGTACTGGATTTGCCGTGTTGCCGGACACTGGTTCCGACTACACGGTGATCAGCCGTTCGCAGTGGAAACTATTGCTCGACGTGGATCCCTCGG
TGCAGGAGATTCCGTTGGAGACGCCGTGTGCAGCCAGTCGTATGATGCACACCAGTCGTGGCTGAGAAGAAAGCCATGCTCATGTCCTGATTCACACGGC
TGCTGGACCGGTGCAGCCAGTGGAAGATGCCGTGTCTGATTGTGGATACGGACGTAGACGAATTCATTATTGGTCAAGACCTGTTGATCGCCCTGGGTAT
CGATGTGGATCGGCAGCTTGAGCAGCTCGCCTCCCATCACGAAGACGATACCGGTGGTGATCCATTTGATTTGGAGGCGGACGACGCCCCGTGAACCGAA
GTCATGTGGCTTCTGATGAAGAAATTCGTGCTGCAGTCGAGACTCTAATTGAAAGAGCCCTGGAGCATAAATCTCCACCCGAAAACGTGGACAAGTTGCG
AACCATCGTGCACATGTACGATGTGTGGCGCCTGGAACCCGTGACGATCCACCTACTCGCGTTCCACCGCTCGAAGTGCGTTTGAAGGATGGGGCTCAAC
CATGCAAATGTAAGCCTCGCAAGTATCCTCCACATGTTCGCCAATTTTTATGTGGGTTTAACGACCAACTTGTGACACTAGGATGGGTCTACAAACTCAA
CAAGTCGCTGGGCAAGCCCCGTTCTCCCCGTCAAAAAATCACAAGAGCCCATGGATTTGCAAATGACCGACTATCGCGAATTCAACTCAATGACCGACAT
CATGGCTGCCGTAATGCCGATTATTTCCTTGGTAATGGAAAATGCACGTGGAAAACAACATTTTGGACTTTTCGACTTCATTAAGGGTTTCTGGCAGCTA
CCTTTAGCTGGGCCTGCCAGGAGTGGTTATCCTACATGACTGATGAGAAGATCTACACTCCACGACGCGTACCACCAGGCTGTGGCGACGCTGCTATCTA
TTTCCAAAAAACTATGGAGGCGTGCTTTGCGACGCTACTGTCAGCACCTCCTCGTGTGGATCGACGACCTGTTGCTCTGCGCGGACGACAGACACTTACC
TGGGCAAACTCGCTGAGTTATTTTCGTTGCTGAATGATTTTGGCCTCAAACTCGGCGTGAAGAAATCCAGCCTGTATCAACAGGAAGTGAAGTGGTGTGG
CAAAATCATCGACGCCAATGGTGTGCGCCATGACCCCGCCACGATTGACTCACTCCGTGCAATGTCGTACCCCAGTACAGCAGGGGAGTTGCAGCAGTTC
TTGTGTGCAATTAATTGGATGCGAGGCAGTCTCATTGACTATGCTCGTCAAGTCTCTCCACTTCAACACCGATTAGATGAAGCTCTGGCCAAGACACGAC
GCACGAAGCGTGTGGCTGCTGGAATTTTAATTGAGCTTAGTGCAGCAGAGAGATCTTCCTTCGACATTGTGAAAGACATGCTAGCCTCAGCGGCTACGCT
TGCTTTCCCGAATGACTCAGCGACGACATGTCTGCTTCGGATATTGGGTGGGCCGTCATTGTGACGTAAGTAAAGGACTTTGACATCAAAGTGCCTGTCC
AGTACCAACAACACCAACTCGCCGAGTGTTTAAGTGGCACCTTCACGGGTAGCCAACTCAATTGGACAGTGATCGAAAAGGAAGCTTTCCCTATCGCACT
GGCCTGTGACAAACTGGATTATTTGCTGCTCCGACCGCAAGGATTCAGGATGTTCTGCGATCACCGCAACTTAATCCACGTGTTGGCTCCTGACGAGCAT
GTCAAAAAGCACGTGAAAGGCAAGTTGTTGCTGTGGTCCATGCAGTTGATGAACTACAACTATGTGATCGAACATATCGCCGGCCCGAACAACGTCTGGG
TCGACATGATCAGCTGGCAGCCACGTCCCAGCCACCAGCAGAATCAGCCGGATTCGAGCTGACACGCCGGCGGCGACAAGCGCTGCATCTCAACAGGAAC
CAGCCAGGGAGGTGACGGGGCCGACCATCTCGACGCTCCGCCCTCTTGATGATAAAAATTTCATCTGACCGACTTTTGTGGAGATTATCCTGGTGTAATC
ACGTTATGAACCACCACCTGGAGTTGTGCGTACCGACGGCGACGTATTCACGCTCCGCGACCAAATTTGGATCCCTACTGAAGCTAGTGATCTCATCTTA
CGACTATTCATCATTGCACACTGTGGTGCTCAAGGTCACGGTGGCCACGCTGCCATGGTGGAGCACCTTCGACGAATGTTTGCGATTGAGAAGCTCAACA
CCCTGGCGTCCACCTTTGTCCGCCAGTGCCGGTTGTGCCTGCATTCAAAAGGGGGGCCATCATCCCCAGACCTTGGGTGAAACAGTTGATTGTTGTGAAC
GCAATCTAGTTTTACATTTCGATTTCCTGTTCATGGGTGATAGTTTGGCGACTCCAGGTATATCCTAGTGCTAAAGGATCATGCCTCGTATTTCTGCGAG
CTTGTCGTGGCAGATACAGCTGACAGTACTGTGACCTTGGAGGCGTTCCTCACCTGGCACTCTCGTTTTGGCCTGCCACCAGTTTGGATCTCGGACCAAG
GATCTCATTTCAAGATCGAAGTGGTGAGTGAGCTGTCGCGCAGGCTGCGCACGCAGCAGCAGTTCGCCCCCGCCTATTGCCCGTGGATAAACGACTCAGT
GTAGCGCGTGAACCGAGATATTCTCCAGGTGATCAGGACAATGATACTGGAGTACAAGATCAACCACAGCGACTGGGTGTACCTGGTACCCATGGTACAG
TCCAGCCTCAATCACACTGCAGTACCTTCACTCGACCACAAAGCGCTGTTTACTGAGCTACCGTGCCCGAAACCTCTCAAAGAATTCTACCTGCCTGGTT
CGGGGGAGATCAAGGAGGCGCCAGCGAGTGGCAAGATTGATGACTTTCTCGTCAACCTGCGAAGCAGTATTCAAGACATGCACAAAGTAGTTGAAGACCA
ACGACTGAAGCAGAGACTGCTGAGCAAGAAGCGGGAGCGAGGAGAGAACATGGTGAACTTCATGGAAGGTGATTATGTGTTACGCTCACGAGTAGCGGCA
ACAAGTTGCTCGTCACCTCGGTAGGGGCGTATCCCGTGCCGATGCACACTCTTTCATGGTTCAACACCTCATCGCGGGTGCCGAGTTGAACGTGCATGCC
TCTAGACTAAAATTCTATGCAGACTCCAGCTTGGACATGACCAAAGAACTGCTCGAGCACATCTCGTCCCAAGGAATCATCTTGGCGGTGGAGAAGCTCA
AGGAGCATCAGTGA