Transcript Name :
Phyra_g12040
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-46
47-69
70-88
89-111
112-158
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        934 bases(100 bases per row)
ATGTTCACAAACAGTGGTGGGAGGAAGCCGATGGCGCCCATTCACAACGTCTGGACCCTGGACGTAGGCCACGTCAAAATCGTCGTGGTTTGCCAACGCC
TCTCCACGTCGAGCCGATCTACGCCGAAATCGCTCTCTCTCGCGTTGCTCCAGTGCTTCTTCCTCAGTCTGTTCTCTGCGGCGTTCCGCATGTTGCTCTT
GGTTTACCCTTCGCGCTTCGGCGCGTTCCTCCTGCGTAAGCTGTGATCTGCGCTCCGCGTGTTGCTCTTGGTTTGCCATCCGTTCTTCAGCACGCTGGTC
CTGCGTAAGCTGTGATCGTCGCTCCGCGTGTTGCTCTGGTTTACCATGCGATCTTCGGCACGCTGCTCCTGCGTAAGCTGTGATCGGCGCTGGGCATGTT
GCTCCTGGTTTACTATCCGTTCCTCGGCACGCTCCTCCTGTGTGAGCTGTGATCGGCGCCGGGCATGTTGCTCTTGGTTTACCATGCGTTCTTCAGCGCG
CTCCTCCTGTGTAAGCTGAGAACGGCGCTCCGCGTGTTGCTCTTGGTTTGCATCCGTTCCTCGCACGCTCCTCCTGTGTGAGCTGTGATCGGCGCTGGGC
ATGTTGCTCTTGGTTTACCATGCGTTCTTCAGCGCGCTCCTCCTGCGTGAGCTGAGACGGCGGTCCGCGTGTTGCTCTTGGTTTACCCTTTGCGCTTCAG
CACGCTCCTCCTGCGTAAACTGAACCCGGCGGTCCGCGTGTTGCTCCCGGTCTGTCCTGCGCTCTTCAGTGCGATCCTGTACACTCCTGTGAAGCGCGCG
AGAAGCACTGTTGCGTTCACGCTCCGCGGCGTGGACCTCTTCGTTCAGATTATGCCGACGTTCCTGCTGTGCGATCCGGTTTCGTTCTCGTACGTCCTGA
AGCTGCTCGGCACGGAGCTGGGCTCGCCGGGCTA