Transcript Name :
Phyra_g5553
Orientation:
(+)
Number of Exons:
2
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ribosomal protein L190.0000012PR00061
Ribosomal protein L190.0000012PR00061
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-194
*** None ***
PositionContextScore
178GKKRVRR|AK0.563
*** None ***
GO
Biological ProcessGO IDPrediction Method
structural constituent of ribosomeGO:0003735IEA
intracellularGO:0005622IEA
ribosomeGO:0005840IEA
translationGO:0006412IEA
*** None ***
*** None ***
Sequence
        649 bases(100 bases per row)
ATGGCTATCGCTTATCGACCGCAGAACCGGGAAGACCACCACTGCACATCGCTGAGCATGCTGGCCGCCGCCACCAAGAGCTTCGTGCGCGCCGCGGGCG
CCGCCGGGTCGCGCCGCGTGCCTCTTTTCAGTGCGCAGGTGTCTCTCTTCTCCGCAGAAGCTTCGCCCGCCGCGCCCGAGCAGCCCAAGCGCGCCAAGCT
CAAGATCCCGACCAAGCGCGCGGCGTCGCTGCTGCTGCAGCTGGAGGCGGAGGCCGTGGCCAAGGCCGCCGAGGGAAAGGACATTGACAACTTCAAGCCC
GGCGATTCGGTGGAGGTGCAGTACCTGCTGAGTCGCACGGGCGCCCGAGTGCAGCGGGTCAAGGGCGTGGTGCTGGCGCGGCGAAACCGCGGCACGGGCA
GCTCGTTCGTCATCCGCAACGTGAGTTTCGATGCGTTTACGCTGCAGCGGTGAGAGGCTAATTATCATTTTATTGTTTGTGACAGCACATTGGCGGCTAC
GGCTACGAGCAGAAGATCTTCCTGCATTCGCCGCTGCTGCAGAGCGTCAAGGTGCTGCAGGAGGCGTTCATCCACAAGGGCAAGAAGCGCGTGCGTCGTG
CAAAGCTCTTCTATCTGCGTGAGAAGGCGCCCAGCTTCACCACCGTCTA