Transcript Name :
Phyra_g1
Orientation:
(+)
Number of Exons:
11
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ubiquitin0.000032PR00348
Ubiquitin0.000032PR00348
Profile scan predictionP-Valprediction_id
Ubiquitin domain12.64PS50053
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
UbiquitinIPR019956
*** None ***
InsideOutsideTMhelix
1-660
NN-scoreoddsWeighted Score
0.5011.9780.004
PositionContextScore
233KKFRQAK|AV0.512
299VAQRVRR|VA0.52
TypeScore
nuclear39.1
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        13863 bases(100 bases per row)
ATGGCCACTCCACGCAGCCCAATTCAGCAGCGCCTTGCAGAGGTATGGTCCGATTACGCTGCGCCCAAACACCACCATCCGAAATGGAATAAATCGGCCT
TCGTCGACGAAGAAACCAGGCTGCTCGCCAAGTATTGGATGGACCAACGGACCGAACTTCTTCACGTGCTGGTTTAGCTGCTCGAGGGACACACCAGCGT
AGTCCTTGACACGGCACAGAGTCTTCTTCGACTCTAGGTCACGCACCAGTCGCGCAAGCACGTCTTCGTGGTCTTTCTTCTTGCCGTTTGCTGCGGTCAT
GGTTGCCGATGCTGTTCTTTCTCGCACTGGCAGAAGCAAACAAGAAAGACCTTGCCCAGTGTGGTCCACGCTACGAATGAATTGACTTCAAATTGAATTG
GTACTTCCACTAAAAAAATGATCAATTCAAATTTGATTCATCAGTGACGGTTCCGAGAACTAGTTCCATACCCAGGAACCGATAGGTAACCGCGGCATAA
TCCGACGCATAATCATGTCGGCAGACCTCCGATCCTCCACGTTGCTGTTTAAATGGCCCGGAAAGTCGGAAAGTGGGCAATTCGCGCTCCACTGGAGGCC
AAGTTGCCCGACATTTGACTTTCCGAGCCAAACAAACAGCAGCCAAAATAATATTTGGGCAGTACCACGATGCACTCATCACCTAGCCCTAATGGATATT
CGCGCGCTCTTTCTTATCGTGCTCTCGCTCTCCATCCGTGAGACCCGAACGAACGTATTGTAGTTCCAGCTCCAGGTCCTCATATTCACATCGTAGCTCA
CGTTTTCCCGATTCGAGCGCCATTTAGACGCAGCAGTTCCGATACACGAGCTTGAATTGTCTCCAGCTGGCGCAGTAGGTCTTCATTAAGCGTTTTCGCT
TCACGAAGTTCTGTTTGCAGCCGGGTTTCCTTCTCCCTGGGCCCTGACGCCTTTGTCGCCGCCTCAAGCTGACCCATGAGTAAGCGCTCACGAGTTTCCA
GCGCGTCTACCCGGCTCTTTAGCCGGCCAACCTCGCTTTGATTGCCACGTTGCTGCTTAAGCTCAAGTAGCGGTAGTTGAGTCTGCTTGTCTTCCAAATC
TTTCTCCAGTTGCTTTCGGCGCTGCTGTTCGACCAATATCTCGTCTTCCAATGAATCTAAACGCTTCCGGAAAGCCTCCCACTTCGTGTTTCGCGCGGTC
CAGTCACGCTCTTTCACTTGCCCGATCGCATTCTCGAGAATTTGGACTTTATCGCTTGACTTTTCACGAACTGTAGATAGCTCCTGGGCCTTTTTCTCCA
TCTCCAGCTCAAGTCGCTGATTTTTCAGGAGTGTTTGTTGTTGCGTCTCCGTTACTAGGTCGTACTGCACAAGGAATTGCTGGTAGGTCGTCTTGATCTG
CATCAACTGATGCTGGAGCTCGCCTACAATTGCGTGATCTTCTGAGGAAGCCATCAAATCACGAAGTCGTTCCTCCTGCTGCTCTAGCTGCCCCACCTCG
TTAATTCTCTCGTACAACAGCGCGTTCTCATTTCGAAGCTCATTGTCATCTCCAGAACGTCCTCTGAGCGGTGGCAACTGCACTAACTCGTCAGAATCGA
CTACAGCCTTTCGATCAGCTACTTCAAGCGTCTTCACGCGCTCCGTTTGCGCCTGTAGCTCGTTCTCAAGTTGATCTATCCGGTCGTGGGGGATATCTGA
ATCGCAACCGGTTTCCCCACTTGTATTTCCTGCACCACTTCTTGCACTCTTTTCGGCTTGAAGAACCATGAGACTATGCTGTGTCTTGGTTAATCGTGCT
GGTAGTTCATACATCGCTAAGTACTTGGCATGCATTTCTGCGTAACTTTCACCCAGTGCGTTGTACTTCTTCAGCACGCCAGTCATTGCACGTTGTTGCT
GATCAGCAAATTCACGAAGCACGCTCTTCTCCAGAGTTTTTTCCATGCGGTCAATCATCTCGTCGGCACCCTGCTTCCACGTCTCTAGGTACAAGACTCG
ATACTTATGAATCTGTTCCGAGTCGTGCAACTCGCCCAGACTGGATATTGGCTGGGTTCCAGCTCGTGGGTGGGGTTTCCTTACGCAGTGAGTGATCGCT
CCCTAACAGCCATTCATAGCCAAAGAATGATGCACGATTTTATCATTGCTGTTCCAGCATTCCACCGCCGTCTCAACATTGTACATTCATTTAATGAATG
CATTTGTGTTGGAGAATGCAATCCAACAAGGACCAATGCAATTGTTGCACCATGCATAATTAATTATGCGCTGTGAGGACGCTGAAACCACAGGCTCGAA
TGGCTATACCTGCTCTAAGAGTTCACACTGACCCAAGTTCCGCAATTGAAATGCCCCGCTTCGACGACAGGTTACCATTCGTTCCCGGGGTGGACTGGTA
GTCTGTCGACCGCTACATAGTGATTCGCACTCGCTATTGTAATGAAACACGATCATTTACATACCCTAGATTCGCGTTCGAGAAGACTGCAAGGCGGAGA
AAGAAGATGTTTTGAAGCAGACAGCGATCACCAGTACTTTCAGCGGATTTTAGTGTCAAATTCACCAATGCCGGGTACGAAGTCTGAAATCCAGAGGCGA
TACGTGAATGTCGGCTATTGTTTGATGAACTTTCGTGTTCACAAAGTGTAGGAAAGTGTAATGCACTTGCGAGGGGTGCTGCTCAGTCCATACATTGGTA
AGGTCTGTCCGTGCAGCTCTCTCAAGTCTAACTGCACGCGTTGTCCTGCAGCCTGCACGCACTTCAACATTGTTCTCATGAACGCAGCATCCGCAGAGGT
GACAAGATGCCCTTCGGGGAATAATGGGTTAAGTGTCAAATTTTACTATCAGATGAAATATAAGTGGCCAATTATCACCAATTGTTTTTACTTTCACGAA
TTTCCCAATTCGAATTTCCGCGAAGAACTTTGCGGAACCACAGCCACTTTTGCCTCGAAACACTCAGCCGCCAAGTTAGAAGCCAAGATGCAGATCCAGA
TCAAGGTACCCACGCCCCCACGCCGCGATCACAGGGGCTGGAAGGGTACTAATAAGTGTGTTTATTGCGCTGGTGTAGACGCTCACTGGCCGGAAGCAGA
CGTTCAACTTTGAGCCGGACAACACGGTACGATGCGATATTCTGGCGCTTCGGACGGTGTGATACTGACGTTGTTTCTCCTTCCGTGAACAGATCCTGCA
TGTGAAGCAGGCCCTGCAGGAGAAAGAAGGTATCCAGGTGGACCAGATTCGTCTCATCTACAGTGGCAAGCAGCTGTACGTGGAGTTAGTCTTGAAACGA
TGAGCTAGACACGGATGTTGATGGCCTTGCTGCTCTACAGAGCCGATGACAAAAATAAAAATACTAAGTATATATAACAATTACTACTAGTAATAGGAAT
GTGCAACTCGTTTTGGATAGTGGATTAAAGTGTAAGGCAAAGCCATCGCAAGAGCGTTGTGGTAAGCATCCACTTTCAAAGTTTCCTTCCATTGAAATTT
TCTCGCCAGAGGTCAGTGAAGATATGATGAAAAAGATAATTTCAGCTCCGATGGATGAAAGAATCACTTGCTTGTGTGGATCATCGATGGAGAGATGGAA
TTTCGCAAAGCACTGCAATAAAGAAAAACATTCGAAGTGGATTAAATCAATGCCATATCCGCAAGATCTTGGGTGGTGGGGCCCAGACTATAGCAAATGG
TAAGCCAGCTATCCAAGTATTATATTTTTATTTTTGATAAATATAAAGTTAGTAATATAGTAAGATGGCGTACTCGTCCGAGCAATACGAACTTAATAAA
GAGCGCATCAAGGCGCTACTATCTAAAGACAAGGGAAACGCGACTGGCGAAGCAGCGAGAATATGATGAGAAGCATCGAACGGAAATTCGTGCTCGTAAG
AAAAAAATATTCAAGCAAGTCGGAACTTAAGCAAATTAACGAAAGCGAACTTAGCTAATTAATTAACACTTTCGCGGTGCAAGGGCGCATTTCTCGCCCT
TTAACGCTGTTTCCAAAACACGGTGACAAATGGACTTCTAAAAGGGCGATTTTTGCGCCCTTTTAGCCTGATCCCGCGCTCGACCTACCGTGTAATATTA
CTACCAATCACAGCATTTTGTTTAAGAGGGATGGGGGTATTTTTCAAATGCTCGCGTCTCCGAGGTGTATTTTATTGCTTCAGCCGCCGTAATCGGCCGC
AGCCGCACCGCCGCGTCATCGACCAAGCGCTGCAAAAACAATGAGCACCAGTATCACCGTGCAGCCAGTCATATCGCCATACATAAGGTAAGTCAAATGC
ACTACATGCTGACTTCATTTCACATACAAAAATTAGCAGAAATGCGCACAAGTTTCACTGACAAAGAAGACAAGCTACTGGTCCAGATCACACTTCAGTT
CGAGAGGGAAGGCCTTCGCATCACCTGGGCATATGTGGCCCGTCGGATGAAAACCAAGCGCTCTGCGAACGAGCTCCGTCTTCGGCTGGCCAGTCTCAAG
AGGACGTACGGGAAGACCATAAGCAGCTTTCCGCGGTGCTTTTTCAGTGGTCTGCCTTCCAGGGGAGTTCTAGTCGCGCGAGCGCGGCCGCCGCCATCTC
TCCTCATTTCCTGGCGACTAATAGCGCCGACGCACGCACCACCTCCCCGTCTCGGCCGCACGCCCTCCACCACAACATCGGCTAGTCTTTCCAACGGATC
AGGCGGTGTTGTCGCCATTGGCACCGACACCAGGTCCTCCTTCAAGTCCGCGAGCAACAGCCCCGACCAGCCCGCGAGCAGCACCGACACCGAGGTCATG
CGCACCAAGTCTGTCCGTGACACCGCCGTCACCAGCTGCCTCGCAGCGGAGTCTGGTGTCCGTGCCGCCATGGACGTCAAGGCCAAGACTTCAGACCGCG
CTGCCACCAAGTCCGTGCGCGGCTCCGTTACCATGCCCAGCCTCTCCGCCGAGGCTGGTGACCGTGTCGGGATCGCCGCCGTAGCCACGTCTGCGGTCAA
CACCACGTCCGAGCCGGCGAGCCACACCATATTCAAGTCTGTGGGCAGTACCACCTTCGCGGGCTGCGTCGCCGCTGAGTCACGTGAAACTATACTCAAC
CCAGGGCAAGCAGCGAAAGCTGTGAATCTCATATTTGCAGGAATCAGTGCGCACGATGTCCGCCAGCAAGCCGGCCGTACTTATGGCAATGCTGGTGAGG
TGTTACCGTCGGGTGTCTCAAAGATACTTGAAGCTGTTGGACCCCTCGGAGAAGCCGACGTTTTCCTCGACGTTGGAGCTGGTGTGGGCAACATTGTCGC
TCAAGTTGCACTTGCGACGAGCGTTAGAACGTGCATTGGCGTCGAGCTTCGAAAGGATCTAGTTGCACTTGAGGTGAAGCGACTTGTCAGTTGGAGAGAT
TGAGCGATTCGGAAGGGACTGATGGCATGAGATCGCGTTTGGAGGAATCGCGATGGAAAGATTGCGGATGTGTCCAGTTATGGCCAGTTGTGTACAGTGG
TGTCCAGTTATGTCCGGTTGTGTTCAGAAGACATCCACCTCCGGATTGAAGTGGATACATGTCGACCTGATGAGTATGGCGTAATCATTTATGCCGACCT
GATCAAGATCGATATTGAGCAATCATTTCGATACGCAATCTGATCCAGATCGACATGCGACAAACATTTCGATACGCGATCTGTACTCACGATTATTGTG
GGTACAATGGACCAATCTTTTCGACACGGTACCGCGATCTTGGTACATCAGACCAAGTTCAAGCTACGGTGTGCAATCAAGGGATGCGCAAGCGGGATAG
GGAGAAAGCAGGATAGGGAGAGATCTTTAGGACCTTTACTTTTGGTTAAGAGATTCAGATTTGCCTTGCAAGACACAAGTGGCGTCCATACTTTCCGGGG
AAGGAATTACATTGGCCTACCCGACGAAGGACCCACCCAGTCGACCAAGGACACGACGCAGACCTGGATAGCTTGGCCAGGGTGCGATCGTCTACTCTCA
TCTCAACTCAAGACCCCGCCAGAGGAGGCGGCAAGCAACGGAAAGGGCTACAACAGCACACCCCAAGGACACCCCCCACGTGATCGACTTGTCCCAAGAC
CCGATCACCAACACCGACGACCGCGTGAAGGATACCCGCGTGGCCGTCACCCACCCATTCCCCGGAAGGAGCAGTCCAGCTCCAACCTCCGCCTTGGTCA
CCCACTGACATCTTCAGTGAACACCGGAAGAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGACTACAAGGTTTTCTGATCACGCCTGATCAACGGA
GTACCCCCTCCGATAGTCGGCAGTCTGGGCCTACCGCTGGCAAGCTCGGATCGCGTCATCGATTTTCGCGATCCCGCTCCGCCACAATGGTGCGCGTGCC
CGGATCTTTGGTGATTCACAGGGATTTCACCGTGAGTCCACCGAAGAAGATGTCAAGATCAAGACGGAACCAGGGAACGAGTCGTCGACGGAAGATGGAT
CGCCGCCGACGGCGCTGAAAGCGCCAGGATCATCTGATCGTGAGAGTGCTGGGAGGAGCTCTGACGATGTGATGGAGGAAGGTTCAGCGATGGACCTAGA
AGAAAAGCCTCCCCTCCCCTCCCCGGGGACCCCCGCGGATCACGATGCGAATCGTGATCCGCCGGACGAAGGTCGACGGTGAAAACCGAAGGACCTTCAT
CCAAAACCACTCCTCCAGCCTCGCCCAACCTCGAAGAAGAAGTCAAGACCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGACCAGGAGGA
TCGCAACACGTGGACGGACGAGCAACTGGAGTCTGCCTTCTTCTACAAGGACCTGTACAAGTTCCTGCACGAAGATCCTGTAATGAAGATCGTGCGTCCG
AAGCCAATTGGGAACTTCAAGGCCGTGAAGGCACCGAAGGAAGTAACCAACTTGAGGCGGTGAAACTTCTGATGCGTATGCTGAAAGAAGCAGGGATCGT
GCTTGGCTCTTTCGACGCGAACGAGTTGTTCGACGTGGAGTTGCCAGTCATCAGGGAATCAACAAACCTGTTTGCGAAACTGACGCCCCTTGTCGGTAGC
GTCGTCCCGGTTCAACGTACAAGACCAACACCGACTCGCAGCCAAACTGGATCGTCACAATATGCCTCAGCCACATCGAAGCGGATCGGACAGCTCGATC
GAGCTGCAGCGGATGACGCTTGGACCGGCTGGAGCAACCATGCTACAATCACGAAAAGAGCGATCGGAAGCCAAGCCGACGGAGATCGCGTCAGCGATCC
AGTCCAAGCGCCGCCCGAACGCATGCAATCGTTTTTTAATGCAGCGATGGAGCGTTTCCTGAAGGAACAGCAAGCGACCGTGACGCCGCCAGCTGCCGTT
CGGAACAGTCCAACCGGAGCTCAAGACGTGGACATGGAGTCCGTGGGATCAAACCGCCTAGATCATCATCGCATCCAAGTGAGTACGATCCGGACGACTT
GAACGTCGGAGTTGCTCCCCGTGCCGCAGTTGCTTCTGCTGGAGCCACTGGCGGCGGACACTCTCTGCCACACGAATCAGGGTTCCGCGATCTCGGAACT
GAAGGAATTCTCCGGGAAGGATAACGACGAAGATCGTGCCAGAAGCTGGTTCGGCAAACTGAAGTCTGCTTTTATCGCGATCAAGCTCCAGATGGCGAGA
AGTGTCTGGTGTTTGGAGATTGCTCACTGGGCCCGCGCAACTGGTACCGACAGCTGAGTCGAACGACGCGTGGCACTGGAAGGGCCTGTCCAAACTTCCA
GACTCAATACTGCGGGCGTGGTGTATCTGTCGCGAGACAATACTACCATGCGCGGAAGAGATCGGATGAATCACCGTTGGAATACCTGCACCGTTGAACG
TCGCTGGTGCGAGCTCAGCTCTCGATCAAGGATGGATCGATCGAGGTTCGCCGTGAGCATGTCGACACTTTATCGAAACGCTCGACGACGCGATCTGGCC
AGCCAATTGGCGCTGTAGGATCCCGGACGCAGACACTCTCGAAGAAACACTGCGATCCCGACAACGCGCGAAGGCGAGGCAAGGAAAACGGTGTATGGGT
CCATCAAACCCAAGCAGAAGACCCAACGGGATCACCCCATCCGCCAACACTCGCGCGGTTCGTACGGTCCGTGCAACGGCTAACTCGAGTGAGTCCGAAC
CGGAAACCAGCGGATCGGAGGGAGAGAGGAGATCTGCGCAAGGTGTACTTTGCGGCAACACCCGATCAGCCGACCGATCGCGATCGGATCAGGATCAACG
CCGTCCTAGTCGAGACTCCAACGACCGCGCCTCGATCGTCCAGCCGGACCTCCTGAAGGAGAATCCCGCGGAAGCCATGCTCCCACTGCGGCTCGTCAAA
GCACACCGATCTTGGTTGCTGGAAACGTCTGACGTGCGAGAAGTGCGGCAAGAAGGGTCACCCTACTGACCGCTGCCTCTTCGTCTGCAAGGCCTGCGGC
GAGATCCACGGAGCTGGAGAATGCCCGATGGAGGAGTTTTACAACTTGATCCGTCAATGGTATAACCCGAACAAGCACGGTGGAATGCTCCCGCAAGCGG
CCGAAAAGATGTTAAACTAGAACGCTCGCCGGGTTTGAATCCGGTACGAGACGAGCGTTCTCAGTTCTGCATCTATGCATATGTCGAAAAACAGTCGAAG
TCAGAGGTGAGTAAGCTGATTCGGCCGACCGACAATACATGTGATCTTCATGACAAACGTACCATGGCGATCTCCAGCCTCCATCAAGTCGACGAATACG
CGGTCGGAGGTGACGATGGCTTTGGATCTCCTGCACGGAGAGTCACGAGGATATTGGAAGTACCATGTGCCGGACAAGAAGTTTCGGCAGGCGAAAGCCG
TGGGGAAGATCAACAACGAAAGAGCCACATTGCTGTTTGACAGTGGCGCCGAGGTGTCCATTCTGGATGCCGCCTTTGCTCGTAAGGTTGGGTGCTACGT
GGACAATAGTCAAGAGTTGGAATGTGAAGGAGTTGGTAAGAATCCCTACATGGCGGAAGTACCAGAATCAAGATCACGCTCGCGGGATCACTGGTGTACT
ACTTCGACGTTTGGGTTGGTCCACCTACCGGTGGCCAAGACCTAATCCTGGGGATGGACTTCATGGTGCCGGCTGGCATCCGCCTCGATCTGGCTGACGG
TCGATAAATCTTCCGGACGAGGTGCGGATTCAGATAGCCGGTCGACGTCAGCTCTACGGGAGAAGGTGTCGCAAGTCAGGCTCGGCGAGCACTGTCAGTT
GGAAGTCGGAGCGTCGGTCGAAGTCCGGAAGGGCTTCATTCCGTCGAGCCACCGAAAGCTGTGGGTTACCCGAGGAGAACGATGGGTGCCGAGTTTGGTT
GCTGGACTAGGGAAACACGCTACCTGAAAATCACGAACATCAGCGATCGGAAGTTAGTGTTGCAAGATGATGCCCACATAGGCATGTGGCTCGAAGGAGG
ACGCGTACCTCCGCTCCTGGTTTCGTACTGATCGGGTCACGCCGGTATGCTGAGTGGCAAAACCTAGCGTTTCAAGCCACACAGATCAGCAACCCGAGGA
AGAACCAGACACGAGGCCCGCTGGACCGATGGTGACCGACCCCAGTACGTCACACCGACGAAGATCTGGAGTCGAGACTCCGGGGCGTCGAAAGTAGCGT
CGCTCAAATCACCGAGTCCCGCCCTGTTGAGACGAAATCGAGGACAAATACCCCCGGGATCAATGGGCGCACGAAGAGGGTAATCCGATCGCGACGGAGA
TGTCGTCAGACAGAATGGAAAGCGAAGACGGGATGCCTATCGGAAGAGCGCCCATGATCGAGCCGAAGACGCCGCCGATCACCGAGTCGGAGATACCAGA
TGACGACGAAGTCTGTTACCATGAAGGAGGCGACTTGTTCGCGGAGACGTGGAAAAGCAGATGGCTGTCTTGCCTGAGGTAGCAACCACTACCGACGAAG
TCACGATCGAAGACATTCAGGTGGGAGACCCTGATTTCAACACCCCTGAGGAGATCGATCGTCTGCGGCAAATCATCTGGCGCCGGCGTCACCTACTGAT
CGGAAAGGGAAACGCGTTACCCCGGCGGCTGTAGGCGCGGTGTGCGACATCGACGTTGGGGGAGCAACTCCGGTCGCCCAACGCGTTCGCCGGGTCGCCC
CACAGTTTCGCGAGAAGCTGTCGGACCTGATCAAGAGTTTGCTGTCTGCGGAGATGATCGTTCCGTCGACCTCGCCGTGGGCATCCCCGATCGTGATCAT
CATCAAGAAGAACGGTGTTGACATCCGACTCTGTATCGATTACAGGCTGGTGAACGGATTGACACGACTGATGGTATATCCCATGCCGATGATCAACGAT
CTCTTGGAAGACTTGGACAAGGTGCTCTGGTACTGCTCCCTCGATATGGCCAGTGGTTTCTGGGTGGTGTCTATGACTGAGCGAGCTCGGAAGATCTCTG
CCTTTGTCACGCCATTCGGACTTTTCGAGTGGACGCGCATGCCTTTTGGGCTGAAGAACGCTCCACAGATTTATCAGAGGCTCATCGACAATGCGTTGTA
TGGCATCTCCGAATCACGCTAGCCATGACTGTCGACGCCGATTGATGTGTTCGAGGCAGGGGAACCAGAGCCGGAACTGAAGCCGTCCGTGCTGGGAAGA
CGGTCGTACATCGACGACATTCTCGTTACGGCGACCACTTGGGATACTTTATGTGAAAAGGTTGAGAGGTTGTTGGACGCTTGCGAACGGTGGAATCTGT
CGATCAGCGTCGTCAAGAGCTTCTGGGGCCAGCGCAAGGTGGGTTACTTGGGCCATCAGGTGTCTGCTGATGGTTTGGAAGCTCACCCGAAGGACCTTGA
GGCGCTGAGTAATCTCCCCTTCCCGCTGACGCTGCGATCGATGCAGTCGTTCCTCGGAAGCTTGAACTACTACAGTCGCTTCATTGAAGACTTCGCGATC
TACGCCGCCGTCTTGTACGAGCTGCGCGAAGCGGACTTTCATGAGATCAGCCGTCTAGAGAGGGTCAACCCTGACCAAAATGACTGGGGGCGACGAACCA
CAGATTCCGGACGCTGATCGCTGGACCCGAGCGAAGATCGCGTTCACAATGCTGAAGGCCAAAATCGTGTCCACACCGATCCTAAAGCATTTCGATCCCG
ATCGCACTCCAGTGATCGTGGTCTACGCGAGTCAGTGGGCGATCTCTGCGGCACTTGTGCAAGAGCATGATGGCGTGTACTGGCCAGTAACTTTCACCAG
TCGTACTTTGAAGTCCAACGAGCTCAACTACGGAATCGTCGACAAGGAAGTCTTGGCGCTTTTACGGATGCTGGACGTGAATTACACCTTGCTGACGACG
AGATCGATCTTGGTGTTGTCCAGGCACTCGACGTTGGCTTGGCTAGTCAACTCAGCCGGTTTCCAGGGAAGACTCGGCAACTGGGCTGCGCTGCTCTCAG
AGTGGACGTTAGAGATCCGGAAATGCGCGAAAGGGGAAGATGAAATCCTGGCGTGATTGCAGCAAGCATCACACCTCGCGCTGAAGTAGACGAAGCGCTG
ATCGCGATTGCGCCGGTGAAACAGCCTCGACAAACGATCCTCATGCCACCCCCTACGGTTGAAGCGGACGAGAATTTGTTAGTCGCGAGCTTCGATGGAT
CAGCACGTGTTAAACGTAGCGGTGGGGCTTACAGCGCGATCATATGGAAGCTCCCCGAGTGGACGATTTTGTCAGCCGCGTCGGAGTACATGCCCGATCT
GACCGTGAACGAAGCTGAGTACCGCGGGTTGTTGTTGTGTTTTGATCTGCTGTCGACTTTGGACCGGGGGCGGATCGTGATCTGCGGTGATTCCAACCTG
GTGATCCGCCAGATGCGTGGTGAGATCGCGTGTAAGGCACAGGTCTGTTGCTGTTGCGCCAAAAGGCAATGGAACGGCTCAGATCGTGGCCGAAACACGA
GTTCCTGCACATGAAGCGAGACTGGAATCAGAGTGCAGACAAGTTAGCGAGCGCCGCTCTCCAACGAGAAGAAGGAACTGTGATTACCTCAGAGGTGATC
GGCAGGACTTGGTCACACTTAACCGTCTGGATGAGCTTCTCAAGCCGAAGGATGACGACGTATTGTCCGGTGTCCGCGGTGACTAGATCAACGCGGCGTC
GGCGATTGCCCCCGAGGCTCTGCAGGAAACGATCATTCAGCGCATGCGAAGTGCGAGTTGTCCAAGCCCAGAATGAGGAAAATGGATCACCGACCTAAAG
GCGTACCTGAAGGAGACGTCGGTAGCTTGACTGCGAAGGAAGCCAAGTCGTGTGCGAAGATCGCGGACGATTACGAGCTGGACGAGAGCGACTTGTTGCT
CTATTGTCCATCATCCATGAAGCAGGACGAGGATCGGGATGAGATCGCAAAGTTGGTGGTCCCAGAGACTCTGCAGCAAGATTTCTTACATCACTATCAT
GCGAGTCTGGAAGGAGGGCATCAGGGGATCGGAAGAACGTACCGACGAATCCGATCGCATTTTCACTGGAGAGGCCTGTACCGAAGTGTCCAACGCTACG
TGGGAGAGTGCACAGACTGTGAGACAGGGAAAGGACGACCCTTCGTGAGAGGAGAGTCCCCGGAAACTTGCAAGCGACGTACCCGTTCCAGATTGTCGCG
ATGGATCACATTCCGTCGCTGCCCAAGTCCTTCAAGGGCAACACGGAGCTGCTGATCTGGGTAGACCTGTTCTCGGGATATGTGATCGCGAAAGCAAGTG
CGTCAAGGACGGCCCAGACGATCGCGGAGAATTATGAAGAGTGTGTATTCCGCCGTTTTGGAGCCAGTGAAGCCATCCGGCACGACAGAGAACCCGGTTT
TATGTCTGATTTCTTCCGTGCATTCAGCCGGATCGTGGGACAAAAACAGAGGCCACGATGGCGTACCGGCCCCAGCAAACGGAACAGCCGAGCGTATGGT
GCAGACGTTGACTCGAGCGTTGAAGATGTACGTCGCAGACGTTAACCAACAGGACTGGGACGAGTACGCAGAACGCCTCACATTCGCAATCAACACGGCC
CAATCGTGTGCGTGGAGACACGCCGTTCTATCTGATCCACGGATGGGACCCACGATCCACGCTGGAAGCGGCGCTACCCGTCGGGAGCACGCGCCGACGT
GATCGCGAGCCAAGACGATGGCGATTCCACATGCAAAGTCAATATCGACGCGCAGGGAGCAGGTAAATGAGCGGCTCCGGGAAGCGATCCAGTCGCGGCC
GACGAACACAACCAGAACGTCCGATCCCAGGAGATTGAGGCTGGTGCACAAGTCTGGCTGTATCTGGACCGGGTGAAGGAAGGCTACGCGAGAAAACTGG
CGCATATGTGGCACGGCCCGTTCCGGGTAGTCGAGATGGTAGGTAATCACGCAGCGAGACTGGAGACTGCTGGCACGGAGTACCGCTTATTCCGATCGTC
CACGTGTCCAAGCTCAAGCTGGTGCGAAGTTTCCCGATCGCCCTACGTTGGCACTTACCGTGGTTGAAGGCGATCGTTTCGATTTTGACGAAGCAATCCT
GCCAGAAGATAGTTGGGAACGCAGCCTTGGCGAAGACGAATACGAGGTTGACAGATTGTGGATGTGCGATCAGGGCGGCGTACGCGCTATGGGCGAGTTC
ATCGAGAGTTCCAAGTGTACTGGAAGGGCTACGAAGATCCATCATGGGTCGACGAGGCCGACCTCAACTGCGGAGCATTGTTGCGTGAGTATGAACGTGA
GGTAACTAACCGCAACCGATTCGGAGTCATGCAGTCGCATGAGGCGGAGGAGGAGGGCTCGTA