Transcript Name :
Phyra_g6
Orientation:
(-)
Number of Exons:
3
Description :
ubiquitin carboxyl-terminal hydrolase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-16
17-39
40-443
NN-scoreoddsWeighted Score
0.6093.9310.008
*** None ***
TypeScore
nuclear34.8
GO
*** None ***
*** None ***
*** None ***
Sequence
        2607 bases(100 bases per row)
TGGGCATTATCTGCTTACCAATTGCCCTCGTGTTGCAGCTTGCCAAATACATCGTCATGGGCATTTTCGCGATCGTTGCCGGTATTTTGTCGGTGCTCTG
GATGCCAGTCACTGCTGTCAAGAATGCGTGGCGGTACGGCAAAGCGCCGCCAGTACTCACCCTCGATGAATTTCATTACTGGCTGGGTCGGAAAGGGTTT
ACCAATGAGGAGATGAAGAAGGTGAAGGAAGCGACCAACGGCATGACGATGCACACACTTGCACGCACACTGACTGATGTGCGGGATGTGGAGAAGCTAT
TCAAGTTGCAGTCGATCGAAAAGCAAAAGTTGGTGGTCGGCATACTTCAACAGTCCAAGGAGGCAATTGACAAGGCACATGAAAGCAAGTTTCAGGAACT
CCGGAAACGGTACACAGGCGCGATCTTCAGCTGGGGGGCCGAAGACGCTTACAGACTAGGCGACGCGATTGCCAAGAACGGGCGAATGTGCAGTCGAGGT
GAAGACGCTCGCAAAAAAGCAGACTGGCAACAACGGGTTGCCTCCAAAGTCAACTTGCGAGTCAACGCAATCTTGCGCTGCATCAACACGATTGCGAACG
AAGGTCGTTTCTCCTCGAACGACGCGAAAATGAGTGACCTGGAGCGGACTGTGAATCGATCCGATAACCCACCGGATTGGAACGAGTTTGTGGTCGACAA
CAAAAACATGACAACAAGTTGTTCGACGAAATTCACACTGCAGCACCTTACATCAAGCAGTACATTGCGCAGGCAATTGTCACCGAATCGTACGCCAGGC
GAGTAGCACGTATTTGCTGGAGCTGGACAGTTTTGTTGGTGCTTGTCGCCTTCCGGCTGGCCAAAGTGGTCCTTAGATTCGAATTCGATGAAATTGGCGA
TGTGATCGACCTCATTGTCGGCACGGTGACTGAACTCGCTGAATCTCCAATGGATGCCTTGGACATTCTCGAAAATGGACTGCCGACAGGCAGCGGAGGT
ACTGGCACCGACGGGAATGGTTTGGGAGGCTCGATAATGAACGTGGTTGACGACAGATTCGGCCGGGACGCACACCTCGAAAACAAGGAAGCGCAGATGA
AGGCATCAATGAAGTGTGAAAAGGTGACCGAGCTCGTCGAGGAATAGAGACCCGCAGTCTCGCCATCGAACGGTAATTAGGATTCGAACAAGCTTCAGCA
GTCCAATGCATCTGAACTTCGCAGTCTAGACTGACTTGAGGAAAAAATTATATCGATTTCTATTCAGCAAGCATTTGTCCTGTGTTTTCAACATGCGGTT
TAGCGAAACGTTTGTCGGTCGAAGGCTACATTCGTTATCCCTGGATAGATTGAGTGACGTTTTTCGTGACCAGGGCCATATCTCGAGAATAGGCAGCACA
GCCGCAATCTCAATCTGAATGGCGCAAATGAGACGCAACAGCGTTAAACGTCAAACCCCAGACTCAATAACAACGGTGTTGGTCGGGAAAACTGCACCAC
AAAGAATATCATGACTTCAACGTCAATATTTCAGTTATTGTTCGAATCCACCGTTACGAACCTGCTTCAGTGATCTTTTTGACCGGAAACACAAAAATGT
CGTGGTGTACCATCGAGTCCGACCCCGGTGCGTCTCTTGTTGCCCCCCAATCCACCGGCCACGCTAACCCCATCCTCCACTGTAGGTGTGTTCACCGCTC
TCATCGAGGACATCGGCGTCCAGGGCGTCCAGGTGGAGGAGCTCTACTCGCTGGACGAGCAGCAGTTCGCCGCCCTGTCGCCAGTCTACGGCCTCGTGTT
TCTCTTCAAGTACGAGGCCAAACACGGGGAGGAGGCCGATCCCCCGGTCTTCGCCTCAGAGGAGGACGGACTGTTCTTTGCCAAGCAGGTGATCAGCAAC
GCCTGCGCTACGCAGGCCATCCTGTCCATCCTGCTTAACTGCCAGGGCCTCGAGCTGGGCGAGACGCTGACCGAGTTCAAGGCCTTCACGAGCGACTTCC
CGTCCGAGTTCAAGGGCCTCGCTATCTCCAACAGCGACAAAATCCGCCTCGCCCACAATTCTTTCGCCAGGGCCGAGCCGTTCGTCGTGGAGGAGAGAAA
AGCAGCCACGGAAGACGATGACGTGTACCATTTCGTGGCCTACGTGCCTGTGAACGGCAAGGTCTACGAGCTGGATGGCCTGCGAGATGGACCGATCTGT
CTGGGGGCGTTCCAGAAGGAGACAACCGTGAAGCGTGGCTGCAGGTGGCGTGCCCCGTTATCCAGAAGAGGATCGAGAAGTACGCGGCCTCGGAGATCCG
CTTCAATCTTCTGGCGCTCGTACGCAACCGGATACAAGCGTTCGAAGAGCAGCTTGGAGCACTCATTGAAGCTGGTGGTAGTGAAGAGCTGGCCGCGCAG
ATCCAGGCGGACCTGGCCGCAGAGCAGCAGAAGCGAAATGACTGGGCGCTGGAGAACAGGCGTCGCAAGCACAACTACATCCCGTTCATTGTTCAGCTGC
TCAAGACGCTGGCGGAGAAGAAGCAGTTGGAACCGCTGACCAAGCAGCAGCTCGACGCCCGCAAAGCCGCTGCTGCGAATACCAAGAAGCCTACGAACGC
GCAGTAA