Transcript Name :
Phyra_g12
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_462099, partial
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-391
NN-scoreoddsWeighted Score
0.5361.1910.002
*** None ***
TypeScore
cytoplasmic56.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        1492 bases(100 bases per row)
ATGGAGACCGTCGAGGCCCAGAAGCTGCTGGCGGAGCTCCACGCGGCGGAGGAGGAGCACGCGCGCGCTCTCGCAGCCGCCAACCAAGTGCGCGACACAT
TGGATCGTACCCGGAAGGAGTACGAGGATGCGCGCACCGCGGAGAAGGCTGGCGAGGACGAGCTGGCCAAGGCAGCGGAGGCGCTGGCGCTTGGACTGCA
GAGTCTCGACGTGGCTGCCAAGGAGGACGCGCCGTACCCGATAATCGCAGACTCGTTGGTGGAATACCACGCCAACATCGGCTGCTACCAGTGTTATTTG
TTCCTAGACAGCCACAAAGACGGCGAGAAGCTGGAGGATGCGACGTCGGAGCTGGACGTCAAGAAGCTCAGCGTTCGAGTGGAATTCCCACGTGTAGAAC
TCACATACAGAGTCAGTGATAGTGCAAAGGACGCTACAATTGTCTGGTGCACGGAGATCGAGCGGAACGTGGACGTCTCGCAGTGTGTGGTGGAAGAGAA
GGGAGATCACTGGTACCTGCGACTGCCGATCTGGCCTAGTGACAAGCAGCCGCTGGGCGGGTTCTCGTCATTTACGCAGGTGTCTCCTGTCGAGCTCCGA
CCGGAGAGTTACGTGTCTGTCAGTTGTCGAGGATGCAATGAATTGCTGCTTGGTGGAGAGGAGATCGCGGGTATTGAGAAGGTTTTGCCGCTGCCATCCG
CCAACTGGATGGACATGTTTGACTTCTGGGGAGCTGGTATTGGCGCCTTTGAGCATATTCCGAGGGATGATATCCATGCCCAGCGACGGCGTGTGCTTGT
TGGCGAGTCGTATGTGCTTCTACACGCTAGTGATTTAATAGCTGGCGCGACGGTGTCCGATCATGGGGACAAGGCGGCGGTCGCACCCGGAGATAATGCG
AAGGAGGAGCGCGAGTGGGTGCCATTGGTATGTACTGCGTGCTCAGAGCGGGTCGGCTTGTGCAGTGTGGAGCAGCCGGATACTGTCCGTCTGCACAAAC
ATTTGATCAGTGCCCATTCGTGCTTTACAGCGAAGACTGAAACTGCAGCAAGCAAGAGCTAGAGGTTCGGCAAGTTTCGGCAAGTATACCCATCGACAGC
ATTCTAAGCGCCAAGCTACTGGAGATGGCGGATTCAGACGGCATTTTCCGGTTCATCTTGACGTCGGGAGGCAAGCACGACCACGATCTGCATTGTGGTG
CTGCTCCAGCTTCACCCGCTGACGCGCCTTCCACAGAGCTGCAGCTGCAGCTATTGAGCTGGGAAACGATGATCAAGCGAAAAGACTCCAACAAGTTTAG
TCGCGTGCTGAAGGTGCTGTATGCACCTCGTCAACCGATGCCAGCGATTCCGGGTCTATTACCTTCGCAGGAAGTAACACTGCCGCCAGCAATGTGCCTG
GCCATCGCCCAGCGACTTGAATCCAGCTCTACGTTGCTGCCATCGTCGCTGCGCGCGTTCAACCGGATGCACGTTGGCTACCTCTTCGCTTG