Transcript Name :
Phyra_g19
Orientation:
(-)
Number of Exons:
9
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Pectate lyase/Amb allergen0.00000065SM00656
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pectate lyase/Amb allergenIPR002022
*** None ***
InsideOutsideTMhelix
1-5
6-28
29-366
367-389
390-1229
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        7092 bases(100 bases per row)
TGCAGTTCTTCCGTCCCATTCTCATTGTGGTGGTGGCTATCGTGGTCCAGGCCACGGACGCCTTCACGGTCGGATCGGCCACCGGTCTCGCTGCCGGAAC
CACAGGCGGAGGCAGCGCCACCCCGTGTACCCCACCACGACGGCGCAGCTCGTCGCGTACCTAAAGGACGCCGTGCCCCGTGTCATCGTGCTCAACAAGA
CGTTCGACTTCCGCGGCACGGAGGGCACGACGACCGAAGCTGGTTGCCGCCCAGACTACACCCGGGAGTGTATCGCCAAGAACAATGGCTACAAGAGCCA
GGATGTCATCCTGCAGAGCGGTGGCATGTCCAACACGGGTGGCTGCTCGGACGGCACCAGCGTGACGGTCACGTACGACAACGCAGCCATCACCCCACTC
ACGGTGACTGGCAGCAAGACCATCCGCGGCATTGGCACGAGCGGTGTCATCATGGGCAAGGGTCTGTGGCTGAACGGCGACAATATCATCGTGCAAAACA
TCCACATCACGGAGCTCAACCGCCACTTGGTGTGGGGTGGCGACGCCTTCTACATGCAGGGCAGCAACGGCGGCTCGACGGCCATGAACAAGATCTGGCT
GGACCACATCAAGGTCTCCCACGTCGGCCGTCAGTTCTTGACGACGAACGCCGCCAGTGTGTCCACGATGACCATCAGCAACTCGGACTTCGACGGCCGC
ACGGACTACTCGGCTACGTGTGACGGTCGCCACTACTGGTCCTTCATCTTCTACGGCAAGAACACCCGCTTCAGCATGCTCAACAACTACGTTCATTCAA
CATCGGGACGCTCGCCCAAGATCGGTGGCGACAGCAGCGCCAACGTCGTCGCGCACATCGCCAACAACTACTGGGCGGACAACTCGGGCCACTCGTTCGA
GATCGGCGTCAACGCATGGGTGCTCGCCGAGGGCAACTACTTCCAGGACACGACGCTGCCGCTGCTGACCGGCTCGGATGGCGCCCTCTACGCCGCCACC
GCCACCACCGAGTGCAACAGCTACCTCGGTCGCTCCTGCGCCGCCAACGTGGTAGACAACAGCGGAGCGTTTCAGTCCCGCAACGGTGCGACGGCTCTAT
CCACGGCAAAGTCGTACTCGGCCATCTCCAGCTACAGTCCGAGCGCGGCGAAGAAGCACAGCAAGACCACCAACAACTTCGGCATCGGCGTGCTCAACTA
AGGTGGCGATGCGCTAGAGTGAAGAAGCATCGCATACACACTACCAGTAGATGTACATGTATTTTGTTTTCTGTAGGCACCGTAGCCGTGCAAAAGTCGC
TGTCGTACAGTTTCAACAACTAAGTCAATACCAACAGCCTCATCGTTCAAGACGTACATCGCGATAACTTCGTCGTGATGACCGTGGCTCACCTTTGTGT
CTTTGTGCGGTTCGTTTTTGATGCAATAGACTGTAGCATCCTTGTGTTGGACCTGACCTCTACATCGTGGTCTTCCTTTTGAAACCACACATCAAAGCAA
ATGGATTCGTACAGAAAAATGCTTCAAGCTTGTTGAAGTGCAGTTTGATAGTTGCTCCGTTGCTGCCAGCAGCAACTTGCTGGTGACCAGGTCTCCCAAT
GAATCTTCGCGCGTGTCGTCGTCATGGATGCCGGTCAAAACATCCTACGCTTTTGGCACCTTCATACGACGTGATCGCCAACAATGCAGCTGGTAACAGC
TCATGCAAAACCTCTCTTTGCTATGGAGGCACACACGGCGTACAAACTCGGAGTCCTCTACCGGCCGCCTAGGTGTGCAGTAGTTATAATAGCACTTTCG
ATTCTGATCGTCTCGACTCTTTTGCCATGAAGCTGTTCTCGATCCTCGTTCTCCTACTGCTCGGCGCTGGTCTCGTCAACGGGTATGCCAACCCCAAGCT
GTGCACCGGAACCTGCACCAACGCCCACGACCCGTCCATTATTCGGCGCGATGATGGCACCTATTTCCGCTTCTCCACGGGCAACAAGATCGCCATCCAC
TCGGCCCCGGCGTTGACGGGCCCATGGACGTATCTCGGAGCTGCAGTGCCCACTGGCTCGAAGATTAATTTGACGGGCAAGGATGATCTCTGGGTGAGTG
TGTTCGTTGTCCCTGGATGTTATCCTACTGATAGTGACCCACTCGTTCTGTTTTGTAGGCCCCAGACGTGCACAAGGTTGGCGACCTGTACTACTTGTAC
TACTCGGTGAGCTCCTTCGGAACTCAAAATTCTGCCGTCGGCCTCACCCGGTCCACGACAATGGAGGCAGGCTCGTGGACCGATCTTGGCAGCATTGGCG
TCACGAGCGACTCGTCTAAGAAGTACAACGCCATCGATCCGAACCTGTTCCAGGTTGGCAGCCAGTACTTCCTCAATTTCAGCAGCTACTGGCAGGACAT
CTACCAGGTGAAGATGAAGTCAACTCCGACGAAAACCGGTGGGGCAGCGGCGTATCAAATGGCGTTCACATCCAACTACGAGGTGGTCGAGGCTGCATAC
ATGTTCTCGTACAACGGCTACTACTATCTCTTCTTCTCGAAGGGCACTTGCTGTGGCTACGACACGTCACGACCTGCCACGGGGAAGGAGTACCGTATCC
TCGTGTGCCGCTCAAAGCATGCTACGTCCGGGTTTGTTGACAAGAACGGCAACGACTGTACGAACAACGGCGGCACGGTTGTGCTCGAGTCTCATAGCTA
CGTCTACGGACCAGGAGGCCAGGGGGTGTACAATGACCCCAAGTACGGCCCCGTGCTGTACTACCACTACGGCAAGCCGCGCTTCATTTACCTTTGTTGT
CCTATTATCACTGACGGCTTTCCTGACTGTTTGGTGCAGTGGACACCCGGATTAGGTATGCGGATGGAGACAAGAAATTCGGTTGGAACCAGCTCGACTT
CTCCAGCGGCTGGCCCACCGTCTAAGCACTCTCAGAGGAGCGAGGAGGGGTCGTCGATGCAGTGTGTCATGAATAGGGTAGAAACCATTCCTATGTTGAT
GGTAATTTTCTTCGGAAGGCCCCTGTTTTGGGAGAACGCTCTTGGGGTTAACTAGCACATGCATGTACCAGGCAGTTGCTACGCCTACGATTCACTGCAT
GTATGAAGAATCTACATGCACCATAAGCTTACGCCAAATTTGTGTCATCCTGACTGACATGCGAACAACGAGAACGCGTTGACAAGTCGTCGCGACAAAT
ACTTGATCGCTCCTGTGCCGTGGCATTCCCTACGGGTGCATTGTCGTGCCGTCAGGCGGAGACTTTGTGTGTGCCAACCGGGATTCAGGAAGAAATGGAT
TCTTGTCAAGATAGGCATTTCAGTGGGGTCCAAGCAAACGCTGCCGATATTTGCATTAGCGCTTTACTACTATTAGAAAGGATTTAGAACCGTTATAAAG
TCGTATTGCCTGCAACTTGTGAATAGAATTCGCTCAATACTACACCTACACTGAAAGCTATGCGCCTCAGAGCTCGTGGTCCAGGTTGCCAATGCGTCTC
GATTCTCGGATGGAGCCGATAATGTTTACCATACACTTGATACGTTTGGGTCCTTGACTCAAGGCTTGAGCACTTCCAGCAAATCCATACAATGCTAATC
CCAGCCGGGACCCTAGATTCATCTGGCGGGTACGCCACGCCACAGTCAGAACATACGAAACGTCGGTGAAAAGTCAACACAACGGTAAAGGCACAGCCTG
ATGGTGGACTGTGCTGTTCGAACGGTGTGGCGTGTCAACGGCCCAACAAGAAGAGCTCTTCACTTTCAATTTTGACAGCACCAATAACGAAGCCGTGCCT
ACTTAAAAGCATGAAGGTGCTCTATTCTCGTCGGACTTCCTCTCCTCGTTGCTGGCCTCGTCAACGGATACACCAATCCTCTAACGTGCACCGGCACCTG
TACCAATGCCCACGATCCGTCCATTATCCGTCGCGATGATGGCACGTACTTCCGCTTCTCCACGGGTAACAAGATTGCTATCCACTCTGCTCCAGACCTG
ACGGGTCCTTGGAAGTACCTTGGAGCAGCAGTCCCGGATGGCTCCAAGATCAATTTGGCCGGCAAGGATGACCTCTGGGTGAGTATTTAATCGCCTTGTC
ACTCCCAATGGTGCTATTTGTTAACGGTCTCGTTCGTCGACTAGGCTCCTGATGTCACCAAGGTGGGCGACATGTACTACCTGTACTACTCAGTTAGCTC
TTTCGGAACTCAAAATTCTGCCATCGGCCTCACCAGGTCCAAGACCATGGAAGCGGGCACGTGGACTGACGCAGGCAGTGTGGGTATCACGAGTGACTCG
TCCAAGAAGTACAACGCTATTGACCCAAACCTGTTCAAGGTTGGCAGTCAGTACTACCTCAATTTCGGTAGCTACTGGCAGGACCTTTTCCAAGCCAAGA
TGAAGTCGACTCCTACGAAGAACTCGGGTGAAACCGCGACCCAGTTGGCCTTCACCTCCAACTACGAGGTTATGGAGGCCGCGTACGAGTTCTCGTACAA
CGGCTACTACTATCTCTTCTTCTCGCAGGGGTCGTGCTGTGGGTACGACAAGACCCGCCCGGCCAAGGGTAAAGAGTACCGCATTCTCGCGTGCCGCTCG
AAGAGTGCGACGTCAGGTTTTGTCGACAAGAACGGAAACGATTGTCGTAACAACGGCGGTACCGTTGTGCTCGAGTCTCACGACTGGGTCTACGGACCAG
GAGGCCAGGGGGTGTACAATGACCCCAAGTACGGGCCCGTGCTGTACTACCACTACGGTAAGCTGCTCTCACTTTGTTCGTCTGTATGTACGCTGTCACC
ATTATCTAACACCATGTTCATTGTAACCTTGACGCGCACGCAGTGGACACTCGAGTTGGATACGGCGATGGCGACAAGCGCTTTGGCTGGAACAAACTCG
ACTTCTCGAGTGGCTGGCCTAAGGTGTAAACTCTCCGTGCCAATGTGCAAGAGTGATAGAAGGAGGAGATGTCTGTGTTACGCCAAACCCAGATTCCTGC
TTGGAACGGCGTGTGATCCAGTGCGTTCTTACAAATATATGTGGATGAAGACGATAAACTAGTATCCGAAGTTTGGAGCACACACTTCAAAGTATTCATG
GCTCTGTGCTTAATTTATTTTGAAGTGAGGATGTCATTTAGTCAATCCTAGCGCCACCTAGTGCTCGTGCCCAAGACCTCTGTGCTTGTCGTGCACCGAG
GGCTCGCTTGTGATTGTTTAGCTGCAAGTTTACGACGACAGGTTGATATAGCGAGGCCACAGCGGCGGTTGCTGCTCGCAACAATCGACGCGCGAAAACG
TGCTCGAACACTTGCGATGCAACACAAAATCAAAATGACTTGCGGCAATGCCCATGGCGATTGCACGAAGCAGCTCCTAAGAGCAATCCAGAATAATCAG
CGGATATGTTTTCGAGGTTGACTCATTTAGCGATGCAACACAAAATCAAAATGACTTGCGGCAGTGCTCATGGCGATTTGCACGAACAGCTCCTAAGAGC
AATCCAGACTAATCAATGGCTACCAAAGGTGCGCTGGTAGTTGTGATGCACTGCGTAGTCTGAATCATGCTACGAAATCTGGTGGCAAATCCGTTCCAGC
CTGCTTCGCTGCAGCGTGCCTCGCGTGTCAGTCGAGTTGCGGACTTAACAGTACTGTACATCTCGGAAGTATTTTATAAGCCTACATTTTGATGTGTCCG
AGTTGAAGCAAATCCGCACTTTGCTGCCTGGAACCGGTACACATGCACTATAATAGTATATTGTACGAAGTGTAGCTCTGTATAGATTCCTGTTGTCCAT
CGATTGTGGATCACTGCATTCTGATGGGCCAAGGTATGAGTCAATAAGATCACTTGCGTCGCAATCGCAGACTCCAGCTGGGATAGCCTTGTAGAGCTGT
TTGAGCCGTATAATTCTGCAGCGAGTCCATTGTGCCTTGCATTTTCGCATTTGACCGTAAGCACCACCTGAGCAATCATGAAGCTTCTCTTGATGCTCGT
CGGACTCCCGCTTCTTGTAGCTGGGCTCGTCAACGGATACGCCAACCCCCAAACGTGCACAGGCGTTTGCACCAACGCCCACGATCCATCCATTATCCGC
CGCGATGACGGCACGTACTTCCGTTTCTCCACCGGCAACAAAATTGCTATTCACTCTGCCCCAGCACTCACGGGCCCGTGGAAGTATCTGGGTGCCGCTG
TTCCGGATGGCTCGAAGATCAATCTCAAGGGCAACGACGACCTATGGGTAAGTTCATGAGACTTGTTTTCAATAATATTTATGCAGTACTGACAAAGTTG
TTCCGCTAGGCCCCCGAAGTGAACAAAATCGGAGACACGTACTACCTGTACTACTCAGTTAGTTCGTTTGGCACCCAGAGCTCTGCTATCGGTCTCACCC
AATCCAAGACAATGGAGGCGGGGTCGTGGGTGGATGCCGGTAGCGTGGGTGTTACGAGTGATTCGTCCAAGCCGTACAATGCCATCGACCCCAACCTCAT
TAAAGTAGGAAGCCAGTACTATCTCAACTTTGGCAGCTATTGGCAGGGTCTTCACCAGACGAAGATGGCGTCGCTACCGGCAAAGAGCTCTGGCGAAACC
GCAAACCAAATCGCCTTCACCTCGAACTTTGAAGTTGTTGAGGCAGCTTTCGAGTTCGCCCACAGCGGCTACTACTACCTCTTTTTCTCCAAGGGTTCGT
GCTGCAAGTACGATCAGACTCGCCCAGCCAAGGGCAAGGAGTACCGAATTCTTGTGTGCCGCTCCAAGAGCCCTACATCGGGTTTCGTCGACAAGAATGG
AGTTGACTGCCGAAACAACGGCGGATCGATCGTTCTTGAGTCGCACGACTGGGTTTACGGCCCAGGAGGCCAAGGAGTGTTCAATGACCCGAAGCACGGC
CCCGTGTTGTACTACCACTACGGTAAGCAAACTTCTTCAGTGCTTTTGATTATGATTATCTTTTGTTGGCTAACGGTTTTGAATGTTTAACACTATGATC
TTGCAGTGGACACTCGCATCGGCTACGCGGACGGTGACAAGCGCTTCGGCTGGAACCAACTCGACTTCTCAAGCGGCTGGCCCACTGTCTAA