Transcript Name :
Phyra_g22
Orientation:
(+)
Number of Exons:
3
Description :
reverse transcriptase, partial
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-177
*** None ***
PositionContextScore
13SWKRFAR|DL0.694
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        706 bases(100 bases per row)
ATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGACCTGCACGATGGACGCATCGAGCAGATCTGCATCTTCTCGGATGTCGAGAGGATGACGT
GTGCAGCGGAAGAGCTGAAGCAGCTCATCACTGAGGGCGCGGAGACCCTCAGCGCGAAGTCGAAGAAGGAACGGTTCGACGAGCAAGGCTGGGACTCGCT
CAAATCGAGTCCCTTTTACAATGTCTTGCGTGAGTACAAGGATGTACTCCGGGCGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGA
TTGATCTCGTGCCGGGAGCAAAGTATTGCGTTACGCGACAGTGACCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAACGTCGTCGCAA
GGCAGGACAAGGGTGGAAATCTAAGTCCCCGCACAGCGCGCCCACGTTATGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCTTACAATAAG
CTAAACGATGCGACGGTACCGGTGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTATTATCTTCAGTACTCTTGATCTGA
GAGACGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCTCTCACAGCGGTAAGCACTCCGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCGCAG
GGTCTG