Transcript Name :
Phyra_g14
Orientation:
(-)
Number of Exons:
3
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-25
26-48
49-84
85-104
105-430
*** None ***
PositionContextScore
54VRHRRRR|RT0.57
57RRRRRTR|QL0.504
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1981 bases(100 bases per row)
TGGCATTGCGAACGTCGCTCGGCAGCAATGCGCACACGCTCGGGGACTCATGCATCGACCTGTACGCCGAGAAGGTCATGATCCCTCGGATCTCGCTCTT
GTCGCTACTCGCGGGGCTCTCGGTGCTCACGACGCTGCTAGTTCGTCACCGTCGACGCCGACGCACTCGCCAATTGGCAAAGCTGCTGCCCGGCAAAGTC
GTCGTTGAGACGTCGACAGCTCCCGAGGACGAGCTTACCACCCGCAAGCGCTGGTTCGCGTGCTTCTTGGCCACGACCGTGGCGTGGATCACCATTTTTC
TATGGAGTTTCCACGCGTCCACGGCGATGACGACCACATCCGCGAGTGGGGCGCAGGGACGACCCCGCATTGTATTCAGCTTTACGACAACTCCGCGAGG
AATCGACGAGATGAAGCCGACGCTGGACGCTCTAGTGCAACAGGAGGGGGACGGATTCGACGCGGTTTACGTGATCGTCCCGAGGACGTATCGAGACAAG
GAGGTGGCCATCCCGACGTGGCTGGTGGACGATGCGTCCACATTGAACCGCACCGAGTTCCGCGGCATCGCGTTTGCTACCGGGGCGAGTCCGTACCACG
ACAAGTTGAGGCTCATTGTGCTGGACACGGACTTTGGTCCAGCCAGCAAAGTGCTGGGAACCCTTTTGGTGGAGCAGGACCCGGAGACCATTATCGTGTA
TGGTGACGACGACCGCGTCTACCCAGCGCAGCTGTGCGAACGTGCACTGCACTACACGCACAAGTTCCCGAGGACGCAATCGCGGTTCTCGGTGGGTGGA
TTTCGGCGGAGGACGGACTGTACTGCGGGCGTAGTCTGGCAGTAGGAGTCAACAGTGTTTCGTTTGTGGGGGAGCTGGGGAGTTGCCGTCAAGAGGAAGT
TTTTCGGGCTTGGAGAAGAGATCATGCCGGCATTTGAGGTCACCAACATGTCCAAGGCGTGTTTCCTGGGTGACGACTATTATCTGTCCCATTTGCTGAG
CAGGAACGGCGTCCGTCGACGGATCGTGTCCGATAGCTGCTGGAACATCGAGGCGCTGACGGAATCGTTCTCTCATGGTGGACTATCGTACGCACCGTCG
GAGCACCCGGGAGGAGCGAACGTCGAGCACTATCAGCAGTGCATTCGCGAACTGGGCAAGGAGCACGACCTGTCTCATGACGGCGAGTTCGGGTCGACTT
ATATGTTCCTCTTCTCTCGTACTTGGGGGTGCTTCGAGGTCTACGGAATTTTTACTTCAGAGGTGAATTCGTGTCATGCTGATGGAGGTCACACCTGTAC
AATAGACTTTCAAAAAGAATATATGAGCCGGCGTGACAATAGCTGATGGTGCTAATCTACAATACCTGGCATCATCCGATAGCGTTGGCCAACCAGAAGA
ATGTGATCTCGAACTCGTGGAGGGAAACTCCACGTACTGTGATCTCGCAAGTTTCCCGGCCAAGAGTTCAAGTGTCTGTGTTCGTGAACAACTCATGACC
ACTTGCCACTCTCCAAATTGCAGTAACAAGATCACCTCAGCGCTCTACAGATGAGTCCTCGCCTGGCTGTATTCGCGCTCTTCTCTATGGTTGTCATGAT
CGCTTGCAGCGTACAGTATGCAGTCGCGATGGAAGGCGAGCTCCGGCTCTACAAGGAGCCAGAATTCAGACGACTACGACGTCTCATGCGTGTTTCGACT
AGCAACCTCTGCTACGACATGCCGTGCGCGTATCTCAACACGATCATTTCGTCTGCAAGATGGTCGGGACTACCGACGACTGGAGCAACGTTCGCGGATG
GCAGATCAAAATCGCCTTCTACGCGGGCAGCAACTGCACGGGTAAAGTCGTCGCCGTGAACACGAACGTCGGACAAGTCGACAATTTTGCAAAGTTCGGG
ATGGACAACGCTACCGCGTCATTCGCGGTGCTGGAGACGTCAACGACGATGCAGCACGAGTCGAGCAACATTTGCGAGTGA